Novel guide rna/cas endonuclease systems

a technology of endonuclease and guide, which is applied in the field of plant molecular biology, can solve the problems of low specificity, costly and time-consuming preparation, and achieve the effect of reducing the number of endonuclease residues, and improving the specificity

Inactive Publication Date: 2019-05-09
PIONEER HI BRED INT INC
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The patent text describes methods and compositions for quickly characterizing new Cas endonuclease systems and their elements. These methods involve using guide RNAs that can recognize and bind to specific target sequences, and optionally nick or cleave them. The guide RNAs are made up of a chimeric non-naturally occurring crRNA and a tracrRNA, which can be from various organisms. The methods can be used to create altered target sites or polynucleotides of interest in plants, plants cells, explants, seeds, and grain. Overall, the patent provides a faster and more efficient way to evaluate and modify new Cas endonuclease systems.

Problems solved by technology

Genome-editing techniques such as designer zinc finger nucleases (ZFNs) or transcription activator-like effector nucleases (TALENs), or homing meganucleases, are available for producing targeted genome perturbations, but these systems tends to have a low specificity and employ designed nucleases that need to be redesigned for each target site, which renders them costly and time-consuming to prepare.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel guide rna/cas endonuclease systems
  • Novel guide rna/cas endonuclease systems
  • Novel guide rna/cas endonuclease systems

Examples

Experimental program
Comparison scheme
Effect test

example 1

Design and Construction of 5N Randomized Protospacer-Adjacent-Motif (PAM) Library for Assaying Cas9 PAM Preferences

[0377]To characterize the Protospacer-Adjacent-Motif (PAM) specificity of Cas9 proteins from Type II CRISPR (clustered, regularly interspaced, short palindromic repeats)-Cas (CRISPR-associated) nucleic acid-based adaptive immune systems found in most archaea and some bacteria, a plasmid DNA library containing a section of 5 random base pairs immediately adjacent to a 20 base pair target sequence, T1 (CGCTAAAGAGGAAGAGGACA (SEQ ID NO: 1), was developed. Randomization of the PAM sequence was generated through the synthesis of a single oligonucleotide, GG-821N (TGACCATGATTACGAATTCNNNNNTGTCCTCTTCCTCTTTAGCGAGC (SEQ ID NO: 2), with hand-mixing used to create a random incorporation of nucleotides across the 5 random residues (represented as N in the sequence of GG-821N). To convert the single stranded template of GG-821N into a double-stranded DNA template for cloning into the ...

example 2

Protein Expression and Purification of Streptococcus pyogenes, Streptococcus thermophilus CRISPR1 and Streptococcus thermophilus CRISPR3 Cas9 Proteins

[0379]To examine the PAM specificity of the Cas9 proteins from the Streptococcus pyogenes (Spy) (Jinek et al. (2012) Science 337:816-21), Streptococcus thermophilus CRISPR1 (Sth1) (Horvath et al. (2008) Journal of Bacteriology 190:1401-12) and Streptococcus thermophilus CRISPR3 (Sth3) (Horvath et al. (2008) Journal of Bacteriology 190:1401-12) Type II CRISPR-Cas systems, Spy, Sth1 and Sth3 Cas9 proteins were E. coli expressed and purified. Briefly, the cas9 genes of the CRISPR1-Cas and CRISPR3-Cas systems of Streptococcus thermophilus (Sth1 and Sth3) were amplified from a genomic DNA sample, while the cas9 gene of Streptococcus pyogenes (Spy) was amplified from a plasmid, pMJ806 (Addgene plasmid #39312)). DNA fragments encoding Sth1, Sth3 and Spy Cas9 were PCR amplified using Sth1-dir / Sth1-rev (ACGTCTCACATGACTAAGCCATACTCAATTGGAC (SEQ I...

example 3

Identification of PAM Preferences for Streptococcus pyogenes and Streptococcus thermophilus CRISPR3 Cas9 Proteins

[0381]To empirically examine the PAM preferences for Streptococcus pyogenes (Spy) and Streptococcus thermophilus CRISPR3 (Sth3) Cas9 proteins, the randomized PAM library described in Example 1 was subject to digestion with purified Sth3 and Spy Cas9 proteins and guide RNA containing a variable targeting domain that hybridizes with, i.e., is complementary to, a sequence in the target DNA molecule (referred herein as target sequence), T1 (SEQ ID NO: 1). Sth3 and Spy Cas9-crRNA-tracrRNA complexes were assembled by mixing Cas9 protein with pre-annealed crRNA and tracrRNA duplex (Table 3) at 1:1 molar ratio followed by incubation in a complex assembly buffer (10 mM Tris-HCl pH 7.5 at 37° C., 100 mM NaCl, 1 mM EDTA, 1 mM DTT) at 37° C. for 1 h. 1 μg of plasmid DNA library with randomized 5 bp NNNNN PAM was cleaved with 50 nM and 100 nM of Cas9 complex in a reaction buffer (10 m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Compositions and methods are provided for novel guide RNA / Cas endonuclease systems. Type II Cas9 endonuclease systems originating from Brevibacillus laterosporus, Lactobacillus reuteri MIc3, Lactobacillus rossiae DSM 15814, Pediococcus pentosaceus SL4, Lactobacillus nodensis JCM 14932, Sulfurospirillum sp. SCADC, Bifidobacterium thermophilum DSM 20210, Loktanella vestfoldensis, Sphingomonas sanxanigenens NX02, Epilithonimonas tenax DSM 16811, Sporocytophaga myxococcoides are described herein. The present disclosure also describes methods for genome modification of a target sequence in the genome of a cell, for gene editing, and for inserting a polynucleotide of interest into the genome of a cell.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This application is the 371 national stage entry of International Application Number PCT / US2016 / 032073, filed on 12 May 2016, which claims the benefit of U.S. Provisional Application No. 62 / 162,377, filed May 15, 2015, U.S. Provisional Application No. 62 / 162,353, filed May 15, 2015 and U.S. Provisional Application No. 62 / 196,535, filed Jul. 24, 2015, each of which is incorporated herein in their entirety by reference.FIELD[0002]The disclosure relates to the field of plant molecular biology, in particular, to compositions for novel guide RNA / Cas endonuclease systems and compositions and methods for altering the genome of a cell.REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY[0003]The official copy of the sequence listing is submitted electronically via EFS-Web as an ASCII formatted sequence listing with a file named 20160502_BB2539PCT_SequenceListing.txt created on May 2, 2016 and having a size 236 kilobytes and is filed concurrentl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12N15/82C12N15/11C12N9/22
CPCC12N15/8213C12N15/11C12N9/22C12N2310/20C12N2800/80C12N15/113C12N15/902C12N2320/10C12N15/1093C12N15/1051C12Q1/6811C12N15/102C40B20/04C12Q2521/301C12Q2525/179C12Q2525/191C12Q2535/122C40B40/06
InventorCIGAN, ANDREW MARKGASIUNAS, GIEDRIUSKARVELIS, TAUTVYDASSIKSNYS, VIRGINIJUSYOUNG, JOSHUA K
OwnerPIONEER HI BRED INT INC