Unlock instant, AI-driven research and patent intelligence for your innovation.

Plasma membrane intrinsic aquaporin for absorbing and transporting neonicotinoid insecticides, and coding gene and use therefor

a technology of intrinsic aquaporin and neonicotinoid insecticide, applied in the field of biochemistry, can solve the problems of no report on the transport of neonicotinoid insecticide by aquaporin, insect paralysis and death, etc., and achieve the effect of improving the transport efficiency of plant neonicotinoid insecticide thiamethoxam

Active Publication Date: 2022-02-10
JIANGSU ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patent is about a new protein called plasma membrane intrinsic aquaporin that can transport neonicotinoid insecticides, such as thiamethoxam, in plants. The patent also describes a method to improve the efficiency of transporting these insecticides using the aquaporin protein. The technical effect of this patent is to enhance the uptake and transport of neonicotinoid insecticides in plants, which can help to increase the efficiency of these insecticides in crop production.

Problems solved by technology

That is, nitrogen atoms in an imidazolidine ring interact with amino acid residues of the insect nAChRs, blocking the receptors and causing the insects to paralyze and die.
Also, there is no report on the transport of neonicotinoid insecticides by aquaporins.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plasma membrane intrinsic aquaporin for absorbing and transporting neonicotinoid insecticides, and coding gene and use therefor
  • Plasma membrane intrinsic aquaporin for absorbing and transporting neonicotinoid insecticides, and coding gene and use therefor
  • Plasma membrane intrinsic aquaporin for absorbing and transporting neonicotinoid insecticides, and coding gene and use therefor

Examples

Experimental program
Comparison scheme
Effect test

example 1

Cloning and Analysis of the Full-Length Encoding Region of BraPIP1;1 Gene

[0025]1. ORF Amplification of BraPIP1;1

[0026]The total RNA was extracted from a root sample of Chinese cabbage according to operation steps of using an RNA simple Total RNA Kit (Tiangen Biotech, Beijing, China). Using 2 g of total RNA as a template and oligo (dT)18 as an anchor primer, and referring to instructions of a Primescript 1st Strand cDNA Synthesis Kit (Invirtrogen), 1st strand cDNA was synthesized. Primers were designed to perform PCR amplification to obtain a single cDNA fragment, and the primer sequences are as follows: upstream primer sequence (SEQ ID NO.3): ATGGAAGGCAAGGAAGAAGACG; and downstream primer sequence (SEQ ID NO.4): TTAGTTTCTGGACTTGAAGG.

[0027]An amplification system is 50.0 μL in total volume, including 20 ng of cDNA, 10.0 μL of 5×Prime STAR buffer, 4.0 μL of 2.5 mmol.L−1 dNTPs, 2.0 μL of 10 mmol.L−1 forward primer and reverse primer each, 1.25 U of PrimeSTAR HS DNA Polymerase, and the b...

example 2

Subcellular Localization of BraPIP1;1

[0030]Referring to Liu et al. (Liu T, et al. Unconventionally secreted effectors of two filamentous pathogens target plant salicylate biosynthesis. Nat Commun 5, 4686. 2014), BraPIP1;1 was constructed into a subcellular localization vector pBinGFP4, and transformed into an Agrobacterium strain GV3101 (deposited in the laboratory of Jiangsu Academy of Agricultural Sciences in the present example, and other commercially available products may also be used in specific applications) by a freeze-thaw method. Tobacco was transformed instantaneously, and fluorescence was observed under a fluorescence microscope after 48 h-60 h. It was found that the green fluorescent signal was mainly distributed on the cell membrane or nuclear membrane (see FIG. 1), indicating that BraPIP1;1 is mainly located on the cell membrane and nuclear membrane related to transmembrane transport.

example 3

Inhibiting the Activity of Aquaporins Can Reduce the Uptake and Accumulation of Neonicotinoid Pesticides in Vegetables

[0031]Referring to the paper (Wenfeng W, Wan Q, Li Y, et al. Uptake, translocation and subcellular distribution of pesticides in Chinese cabbage (Brassica rapa var. chinensis)[J]. Ecotoxicology and Environmental Safety, 2019.), water channel inhibitors, mercuric chloride and glycerol, of different concentrations were added to equal volumes of Hoagland nutrient solutions containing 2 mg / L nicotine compounds (thiamethoxam, imidacloprid, acetamiprid, nitenpyram, dinotefuran and nicotine). After 48 h, the concentrations of the nicotine compounds in the Chinese cabbage plants (with three leaves and one bud) were determined respectively. Each treatment was repeated five times.

[0032]To determine whether aquaporins can transport the neonicotinoid insecticide molecules and nicotine, the water channel inhibitors mercuric chloride (HgCl2) and glycerol of different concentration...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
total volumeaaaaaaaaaa
total volumeaaaaaaaaaa
total volumeaaaaaaaaaa
Login to View More

Abstract

The disclosure discloses a Chinese cabbage plasma membrane intrinsic aquaporin, having an amino acid sequence as set forth in SEQ ID NO. 2, and the nucleotide sequence of the encoding gene BraPIP1;1 thereof is as set forth in SEQ ID NO. 1. The plasma membrane intrinsic aquaporin has the characteristic of sensitively responding to neonicotinoid insecticides (thiamethoxam, imidacloprid, etc.) in the external environment. At the same time, it has the function of mediating transmembrane transport of the neonicotinoid insecticides, promoting accumulation of the neonicotinoid insecticides in plant roots and leaves, which has important application value in guiding efficient and simple use of pesticides, development of new systemic pesticides, etc.

Description

TECHNICAL FIELD[0001]The disclosure belongs to the technical field of biology, and in particular relates to a plasma membrane intrinsic aquaporin derived from Chinese cabbage and application thereof in improving the transport and utilization efficiency of crop neonicotinoid insecticides.BACKGROUND ART[0002]Neonicotinoid insecticides (such as thiamethoxam, imidacloprid, acetamiprid, nitenpyram and dinotefuran) have become the fastest growing insecticides in the global market, accounting for 24% of the insecticide market and 80% of the seed coating agent market. Neonicotinoid insecticides are synthetic compounds similar to the natural insecticide nicotine in structure, and target nicotinic acetylcholine receptors (nAChRs) in the central nervous system of insects. That is, nitrogen atoms in an imidazolidine ring interact with amino acid residues of the insect nAChRs, blocking the receptors and causing the insects to paralyze and die. Such mechanism makes the neonicotinoid insecticides ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C07K14/415C12N15/82
CPCC07K14/415C12N15/8286C12N15/81C12N15/8261Y02A40/146
Inventor YU, XIANGYANGWAN, QUNLI, YIXINCHENG, JINJINWU, RUOHAN
Owner JIANGSU ACAD OF AGRI SCI