Plasma membrane intrinsic aquaporin for absorbing and transporting neonicotinoid insecticides, and coding gene and use therefor
a technology of intrinsic aquaporin and neonicotinoid insecticide, applied in the field of biochemistry, can solve the problems of no report on the transport of neonicotinoid insecticide by aquaporin, insect paralysis and death, etc., and achieve the effect of improving the transport efficiency of plant neonicotinoid insecticide thiamethoxam
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Cloning and Analysis of the Full-Length Encoding Region of BraPIP1;1 Gene
[0025]1. ORF Amplification of BraPIP1;1
[0026]The total RNA was extracted from a root sample of Chinese cabbage according to operation steps of using an RNA simple Total RNA Kit (Tiangen Biotech, Beijing, China). Using 2 g of total RNA as a template and oligo (dT)18 as an anchor primer, and referring to instructions of a Primescript 1st Strand cDNA Synthesis Kit (Invirtrogen), 1st strand cDNA was synthesized. Primers were designed to perform PCR amplification to obtain a single cDNA fragment, and the primer sequences are as follows: upstream primer sequence (SEQ ID NO.3): ATGGAAGGCAAGGAAGAAGACG; and downstream primer sequence (SEQ ID NO.4): TTAGTTTCTGGACTTGAAGG.
[0027]An amplification system is 50.0 μL in total volume, including 20 ng of cDNA, 10.0 μL of 5×Prime STAR buffer, 4.0 μL of 2.5 mmol.L−1 dNTPs, 2.0 μL of 10 mmol.L−1 forward primer and reverse primer each, 1.25 U of PrimeSTAR HS DNA Polymerase, and the b...
example 2
Subcellular Localization of BraPIP1;1
[0030]Referring to Liu et al. (Liu T, et al. Unconventionally secreted effectors of two filamentous pathogens target plant salicylate biosynthesis. Nat Commun 5, 4686. 2014), BraPIP1;1 was constructed into a subcellular localization vector pBinGFP4, and transformed into an Agrobacterium strain GV3101 (deposited in the laboratory of Jiangsu Academy of Agricultural Sciences in the present example, and other commercially available products may also be used in specific applications) by a freeze-thaw method. Tobacco was transformed instantaneously, and fluorescence was observed under a fluorescence microscope after 48 h-60 h. It was found that the green fluorescent signal was mainly distributed on the cell membrane or nuclear membrane (see FIG. 1), indicating that BraPIP1;1 is mainly located on the cell membrane and nuclear membrane related to transmembrane transport.
example 3
Inhibiting the Activity of Aquaporins Can Reduce the Uptake and Accumulation of Neonicotinoid Pesticides in Vegetables
[0031]Referring to the paper (Wenfeng W, Wan Q, Li Y, et al. Uptake, translocation and subcellular distribution of pesticides in Chinese cabbage (Brassica rapa var. chinensis)[J]. Ecotoxicology and Environmental Safety, 2019.), water channel inhibitors, mercuric chloride and glycerol, of different concentrations were added to equal volumes of Hoagland nutrient solutions containing 2 mg / L nicotine compounds (thiamethoxam, imidacloprid, acetamiprid, nitenpyram, dinotefuran and nicotine). After 48 h, the concentrations of the nicotine compounds in the Chinese cabbage plants (with three leaves and one bud) were determined respectively. Each treatment was repeated five times.
[0032]To determine whether aquaporins can transport the neonicotinoid insecticide molecules and nicotine, the water channel inhibitors mercuric chloride (HgCl2) and glycerol of different concentration...
PUM
| Property | Measurement | Unit |
|---|---|---|
| total volume | aaaaa | aaaaa |
| total volume | aaaaa | aaaaa |
| total volume | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


