Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

95results about How to "Efficient way" patented technology

Method for producing biodiesel by high-density fermentation of heterotrophic chlorella

InactiveCN101230364ALow raw material costOptimizing conditions for heterotrophic fermentationFatty acid esterificationUnicellular algaeBiodiesel feedstockBiodiesel
The invention discloses a method of producing bio-diesel by fermenting the heterotrophic chlorella in high density which belongs to the renewable biological energy field. The method uses the heterotrophic chlorella fermented in high density in the bio-reactor as a raw material, which screens the chlorella species having high growth rate and high oil content, directly inoculates into the bottle as the first-class germ to culture then transfers to the fermentation cylinder to undergo the second-glass high density fermentation; the reaction condition is then optimized, and the process is controlled; the culture containing the carbohydrate is dripped to provide the nutrition for the cell growth, therefore the heterotrophic chlorella cells cultured in high density with density of 108g / L and oil content of 61 percent are separated, collected and dried; the algae oil is extracted, and the bio-diesel is produced by transesterification reaction; the invention reduces the cost for the raw material of bio-diesel, and satisfies the demand of industrialized application of producing bio-diesel by heterotrophic chlorella cells, therefore the technique of the invention becomes an economical and effective way of making oils from bio-diesel materials.
Owner:TSINGHUA UNIV

Uniform-pressure electromagnetic forming device, uniform-pressure coil and obtaining method thereof

The invention provides a uniform-pressure electromagnetic forming device, a uniform-pressure coil and an obtaining method thereof. The uniform-pressure electromagnetic forming device comprises a conductive channel, a coil and a workpiece. The U-shaped conductive channel is formed in an upper-portion surrounding coil of the coil, the workpiece is arranged below the coil, and the workpiece and the conductive channel form a current loop. The coil comprises a lead, an epoxy plate and a reinforcing material. A framework composed of the epoxy plate provides supporting for the lead. The reinforcing material is arranged on the outer side of the lead to serve as an outer reinforcing layer and used for providing enough strength. During work, eddy current is sensed in the workpiece and the conductive channel due to the influence of changing current in the coils, and the current loop is formed. Due to the fact the coil is formed by winding multiple layers and turns of thinner red copper leads, an electromagnetic force exerted in the workpiece is large, and the forming efficiency is higher. For ensuring the strength of the coil, the reinforcing material is wound and reinforced in the coil lead winding direction and the winding direction perpendicular to the lead respectively, and high-strength and efficient uniform-pressure electromagnetic forming is achieved.
Owner:HUAZHONG UNIV OF SCI & TECH

Single vanadium extraction and steelmaking method by converter

The invention discloses a single vanadium extraction and steelmaking method by a converter. The method comprises the following steps: carrying out KR stirring and desulfurizing on vanadium-containing molten iron to ensure that the sulfur content is reduced to 0.001-0.060%; then, fishing out over 97% of desulfurized slag in the vanadium-containing molten iron; blending the fished vanadium-containing molten iron into the converter filled with liquid vanadium-containing slag; adding vanadium-containing solid wastes for pure oxygen blowing to extract vanadium and make steel; in the blowing process, adding a proper amounts of lime, calcined dolomite and a compound slag former to form slag; then, adjusting the tilting angle of the converter; and pouring out the vanadium-containing slag from a fire door, wherein the vanadium-containing slag is used for extracting vanadium while semisteel left in the converter is continuously blown to prepare initially blown molten steel. The method disclosed by the invention realizes enrichment and cyclic utilization of vanadium resources by fully utilizing the beneficial element vanadium in the liquid vanadium-containing slag and the vanadium-containing solid wastes, thereby forming an efficient path for recycling slag and solid wastes generated by steelmaking of vanadium-containing molten iron. No special coolers are additionally added, so that the resources of the solid wastes are fully utilized and the economic benefit is good.
Owner:PANGANG GROUP CHENGDU STEEL & VANADIUM

Augmented reality subtitle glasses for simultaneous translation

PendingCN109696748ASolve the inconvenience of communicationEfficient waySpeech recognitionTeaching apparatusMicrocontrollerIdentity recognition
The invention relates to a pair of augmented reality subtitle glasses for simultaneous translation, which is provided with the equipment such as a voice receiving module, a voice / text conversion module, an embedded microcontroller, a memory, an identity recognition module, a text input module, a text / voice conversion module, a voice output module and a display screen, and is characterized in thatthe mutual conversion between voice and texts is realized through the voice / text conversion module and the text / voice conversion module in the AR glasses, the simultaneous translation between different languages is realized through a translation module, text information is presented on the display screen of the AR glasses as subtitles, and a user A and a glasses wearer can know what the opposite side expresses through browsing the subtitles on the display screen or directly listen to the voice broadcast. the problem of inconvenient communication between different types of people is effectivelysolved through the augmented reality subtitle glasses for simultaneous translation, thereby not only providing a good way for the deaf to return to the normal life and reintegrate into the society, but also being capable of realizing the simultaneous translation between Chinese and foreign languages.
Owner:郑州诚优成电子科技有限公司

CFD-based heavy metal wastewater sulfuration precipitation reactor optimization method

The invention discloses a CFD-based heavy metal wastewater sulfuration precipitation reactor optimization method. The method comprises the following steps: establishing a fluid computational domain geometric model of a sulfuration precipitation reactor; according to the established geometric model, determining a control equation and defining a boundary condition and an initial value of the model according to an actual situation and a design thought; meshing the geometric model of the sulfuration precipitation reactor, and solving flow field and reaction substance concentration distribution and the like of the model by using multi-physical field coupling; by modifying related parameters, repeating the process, performing multiple numerical simulation calculations, and comparing and analyzing calculation results under different geometric structures and technological parameters to obtain the optimal reactor structure and technological parameters. According to the invention, simulation calculation can be carried out on the sulfuration precipitation process under different reactor structures and process parameters to obtain results such as inlet and outlet water concentrations of the reactor, flow field distribution characteristics in the reactor, concentration distribution of each substance and the like so as to evaluate the reactor performance under different conditions.
Owner:CENT SOUTH UNIV

Pear transcription factor PbrMYB169 and application thereof

The invention discloses a pear transcription factor PbrMYB169 and an application thereof. The pear transcription factor PbrMYB169 is separated from Dangshan crisp pears, and has MYB family member PbrMYB169 genes capable of adjusting and controlling development of sclereid of pear fruits, the nucleotide sequence of the pear transcription factor PbrMYB169 is as shown in SEQID No.1, and the coding amino acid sequence of the pear transcription factor PbrMYB169 is as shown in a sequence table SEQID No.2. Through an agrobacterium tumefaciens mediated heredity conversion method, PbrMYB169 transcription factors are converted into arabidopsis thaliana, and transgenic plants are obtained; biological function verification indicates that the PbrMYB169 gene cloned through the pear transcription factorPbrMYB169 has the function of promoting synthesis of arabidopsis thaliana inflorescence stem lignin, besides, the PbrMYB169 transcription factor has the advantage of being capable of adjusting and controlling a plurality of genes, and an efficient way is provided for molecular breeding. New genetic resources are provided for reduction of molecular breeding of synthesis of organism lignin, new heredity resources are provided for implementing green agriculture, and reduction of the agriculture cost and realization of an environmental-friendly purpose can be facilitated through development and utilization of the heredity resources.
Owner:NANJING AGRICULTURAL UNIVERSITY

Projection Moire gear tooth surface three-dimensional measurement device and measurement method

InactiveCN111189408ASolve the occlusion problem of non-contact measurement of shape errorEasy to interfereUsing optical meansPoint lightGrating
The invention relates to a projection Moire gear tooth surface three-dimensional measurement device and measurement method. The device comprises a point light source, a measuring grating and a semi-reflection semi-transmission mirror are sequentially arranged on a light path of the point light source, an included angle of 45 degrees is formed between the semi-reflection semi-transmission mirror and the light path, and a lens, a reference grating and an industrial camera are sequentially arranged on a reflection light path by which the point light source passes through the semi-reflection semi-transmission mirror. The point light source is composed of an optical fiber support, optical fiber and a light source, one end of the optical fiber is connected to an emission end of the light source,and the other end is erected on the optical fiber support. According to the invention, a light path propagation path is changed through the semi-reflection semi-transmission mirror, compared with theuse of a reflecting mirror, the reflecting mirror needs to be installed in a tooth groove, the fixation is complex, interference with the measurement device easily occurs, while the semi-reflection semi-transmission mirror can be installed outside a tooth groove of a measured gear, the structure is simpler, the implementation is easy, meanwhile, optimal projection and data acquisition can also berealized, and the measurement is free of light shielding.
Owner:XIAN TECHNOLOGICAL UNIV

SSR (simple sequence repeat) marker for cucumber leaf color mutant genes v-1 and application thereof

The invention discloses an SSR (simple sequence repeat) marker for cucumber leaf color mutant genes v-1 and an application thereof, relating to a plant breeding assistive technology. The nucleotide sequence of a primer of the SSR marker which is closely linked with the cucumber leaf color mutant genes v-1 is as follows: SSR8v-1-F / SSR8v-1-R: GGCAATGGTAAAGGTTGGAA / AAGGGATGTGTGGTGTGGTT; a characteristic strip of the SSR marker linked with the leaf color mutant genes v-1, which is amplified by the primer, is 194bp, and the nucleotide sequence is as shown in Seq ID No. 1; the characteristic strip of the SSR marker linked with leaf green genes V-1, which is amplified by the primer, is 206bp, and the nucleotide sequence is as shown in Seq ID No. 2. By adopting the SSR marker obtained according to the invention, the leaf color mutant genes v-1 can be screened in any stage against plant materials; the SSR marker has the advantages of high efficiency, few limitations and accuracy, and can improve the selection efficiency and accuracy of breeding plant high-light efficiency yellow leaf materials and also provide a simple, convenient and efficient way for assisted breeding of high-light efficiency breeding materials by utilizing the SSR marker which is co-segregated from leaf color control genes.
Owner:INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI

Formaldehyde monitoring and processing integrated equipment and formaldehyde processing method

InactiveCN106178927AConvenient and quick formaldehyde detection and treatmentGood processing effectProgramme controlComputer controlEnvironmental resistanceProcess engineering
The invention provides formaldehyde monitoring and processing integrated equipment. The formaldehyde monitoring and processing integrated equipment comprises a formaldehyde detection module, a signal adjusting and amplification circuit electrically connected with the formaldehyde detection module, a control module electrically connected with the signal adjusting and amplification circuit, and a display module and a gas processing apparatus electrically connected with the control module, wherein the gas processing apparatus comprises an air pump electrically connected with the control module, a water tank connected with the air pump, and a gas distributor arranged at an outlet of the air pump and positioned in the water tank. The invention also provides a formaldehyde processing method based on the formaldehyde monitoring and processing integrated equipment. The formaldehyde monitoring and processing integrated equipment and the formaldehyde processing method can simultaneously perform formaldehyde monitoring and performing corresponding treatment according to the monitoring condition, and have the advantages of good formaldehyde processing effect, high efficiency, no pollution, safety, and environmental protection.
Owner:宁波高新区绿邦科技发展有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products