Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

95results about How to "Efficient way" patented technology

Method for producing biodiesel by high-density fermentation of heterotrophic chlorella

InactiveCN101230364ALow raw material costOptimizing conditions for heterotrophic fermentationFatty acid esterificationUnicellular algaeBiodiesel feedstockBiodiesel
The invention discloses a method of producing bio-diesel by fermenting the heterotrophic chlorella in high density which belongs to the renewable biological energy field. The method uses the heterotrophic chlorella fermented in high density in the bio-reactor as a raw material, which screens the chlorella species having high growth rate and high oil content, directly inoculates into the bottle as the first-class germ to culture then transfers to the fermentation cylinder to undergo the second-glass high density fermentation; the reaction condition is then optimized, and the process is controlled; the culture containing the carbohydrate is dripped to provide the nutrition for the cell growth, therefore the heterotrophic chlorella cells cultured in high density with density of 108g / L and oil content of 61 percent are separated, collected and dried; the algae oil is extracted, and the bio-diesel is produced by transesterification reaction; the invention reduces the cost for the raw material of bio-diesel, and satisfies the demand of industrialized application of producing bio-diesel by heterotrophic chlorella cells, therefore the technique of the invention becomes an economical and effective way of making oils from bio-diesel materials.
Owner:TSINGHUA UNIV

On-line queuing length detection method based on floating vehicle data

ActiveCN102855760AReduce manual investigationReduce signal timing calculationsDetection of traffic movementSimulationGlobal Positioning System
The invention provides a high-practicability, high-efficiency and low-cost on-line queuing length detection method based on floating vehicle data. The method comprises the following steps of: 1, matching the current position of a vehicle with an electronic map according to positioned information of a global positioning system (GPS); 2, counting parking times according to a preset time interval, a counting interval and a parking point; and 3, estimating a queuing length, and adding limits of error for correction.
Owner:SUN YAT SEN UNIV

Method for building multi-core operating environment

The invention provides a method for a building multi-core operating environment, which is characterized in that: a plurality of pieces of cpu are divided into two groups in advance, wherein one group is on-line cpu which operates a standard Linux operating system for checking message content, and the other group is an off-line cpu for operating a specified target code; when all cpu relevant resource finishes initializing, parts of on-line cpu become the off-line cpu; the off-line cpu operates one endless loop function cpu_idle so as to embed the code inlet function of a specified target into the endless loop function cpu_idle; the off-line cpu operates the specified target code to classify and distribute received network message to the corresponding on-line cpu according to data flow. Theinvention can solve the problem that cpu cost sharp increases along with the increase of cpu amount under the Linux environment and provides a new efficient path for multi-core framework development.
Owner:BEIJING TOPSEC NETWORK SECURITY TECH

Heavy rare earth element attachment method for sintered NdFeB magnetic body

The invention discloses a heavy rare earth element attachment method for a sintered NdFeB magnetic body. The heavy rare earth element attachment method for the sintered NdFeB magnetic body includes that enabling two surfaces of a pre-processed sintered NdFeB magnetic body to stay close to an isolating layer coated with powder with heavy rare earth hydride, performing diffusing heat treatment, and enabling the heavy rare earth hydride to enter the magnetic body through grain boundary diffusion after dehydrogenation so as to effectively improve the coercive force of the magnetic body. The heavy rare earth element attachment method for the sintered NdFeB magnetic body is simple in technique, low in equipment requirement, suitable for industrial production and worthy of popularization.
Owner:许用华

Heavy rear earth adhering method of sintered NdFeB magnet

The invention provides a heavy rear earth adhering method of a sintered NdFeB magnet, and belongs to the technical field of rear earth magnetic functional materials and preparation. The preparation technology particularly includes the steps that the sintered NdFeB magnet after surface pretreatment is placed in a heavy rear earth salt organic solution, under the action of currents, heavy rear earth elements are deposited on the surface of the sintered NdFeB magnet and form a dense heavy rear earth metal thin layer, and then the heavy rear earth elements in a heavy rear earth metal film diffuse into the magnet through grain boundaries in the process of high temperature diffusion treatment or high temperature diffusion and low temperature tempering two-stage thermal treatment. Coercivity of a sintered NdFeB rear earth permanent magnetic material prepared through the method is remarkably improved, remanence is not obviously reduced, heavy rear earth consumption is small, the process is simple and controllable, efficiency is high, and the method is suitable for industrial production.
Owner:UNIV OF SCI & TECH BEIJING

Uniform-pressure electromagnetic forming device, uniform-pressure coil and obtaining method thereof

The invention provides a uniform-pressure electromagnetic forming device, a uniform-pressure coil and an obtaining method thereof. The uniform-pressure electromagnetic forming device comprises a conductive channel, a coil and a workpiece. The U-shaped conductive channel is formed in an upper-portion surrounding coil of the coil, the workpiece is arranged below the coil, and the workpiece and the conductive channel form a current loop. The coil comprises a lead, an epoxy plate and a reinforcing material. A framework composed of the epoxy plate provides supporting for the lead. The reinforcing material is arranged on the outer side of the lead to serve as an outer reinforcing layer and used for providing enough strength. During work, eddy current is sensed in the workpiece and the conductive channel due to the influence of changing current in the coils, and the current loop is formed. Due to the fact the coil is formed by winding multiple layers and turns of thinner red copper leads, an electromagnetic force exerted in the workpiece is large, and the forming efficiency is higher. For ensuring the strength of the coil, the reinforcing material is wound and reinforced in the coil lead winding direction and the winding direction perpendicular to the lead respectively, and high-strength and efficient uniform-pressure electromagnetic forming is achieved.
Owner:HUAZHONG UNIV OF SCI & TECH

Measuring label

The invention relates to the field of labels, in particular to a measuring label. The measuring label comprises a label body, a color changing area and an information area, and the color changing areaat least comprises a color changing area which is made of changing materials used for sensing preset environment parameter changes. The measuring label has the advantages that compared with the priorart, a part capable of achieving the environment measuring function is added to a traditional label application mode by designing the measuring label, the application range of entity labels is further expanded, the environment measurement function and a data carrier are integrated in the label, the data of the environment where the label is located can be sensed besides the basic function of information recording, and a low-cost and high-efficiency data bearing and data measurement and acquisition mode is achieved.
Owner:陈浩能

Single vanadium extraction and steelmaking method by converter

The invention discloses a single vanadium extraction and steelmaking method by a converter. The method comprises the following steps: carrying out KR stirring and desulfurizing on vanadium-containing molten iron to ensure that the sulfur content is reduced to 0.001-0.060%; then, fishing out over 97% of desulfurized slag in the vanadium-containing molten iron; blending the fished vanadium-containing molten iron into the converter filled with liquid vanadium-containing slag; adding vanadium-containing solid wastes for pure oxygen blowing to extract vanadium and make steel; in the blowing process, adding a proper amounts of lime, calcined dolomite and a compound slag former to form slag; then, adjusting the tilting angle of the converter; and pouring out the vanadium-containing slag from a fire door, wherein the vanadium-containing slag is used for extracting vanadium while semisteel left in the converter is continuously blown to prepare initially blown molten steel. The method disclosed by the invention realizes enrichment and cyclic utilization of vanadium resources by fully utilizing the beneficial element vanadium in the liquid vanadium-containing slag and the vanadium-containing solid wastes, thereby forming an efficient path for recycling slag and solid wastes generated by steelmaking of vanadium-containing molten iron. No special coolers are additionally added, so that the resources of the solid wastes are fully utilized and the economic benefit is good.
Owner:PANGANG GROUP CHENGDU STEEL & VANADIUM

Chromium-polluted soil cleaning method enhancing ion migration

The invention relates to technology for cleaning heavy metal-polluted soil, in particular to a chromium-polluted soil cleaning method enhancing ion migration. The method comprises the following steps of: inserting an electrode into soil to be cleaned; applying a direct current electric field to the soil; injecting cleaning liquid into the polluted soil to make chromium ions in the polluted soil migrate directionally under the action of electric field force; continuing to add the cleaning liquid; standing and electrifying the polluted soil; and performing the previous steps circularly until the pollutant concentration of the soil reaches a treatment target. The method has the advantages of solving the problem of slow qualitative migration of heavy metal pollutants in low-permeability polluted soil, shortening repair time and recycling chromium-containing cleaning liquid.
Owner:SHENYANG INST OF APPLIED ECOLOGY - CHINESE ACAD OF SCI

Preparation and Application of Universal Targeting CD19 Antigen Chimeric Receptor T Cells

The invention relates to a preparation and an application of universal targeted CD19 antigen chimeric receptor T cells. Concretely, the invention relates to a method for preparing targeted CD19 antigen chimeric receptor T cells. The method comprises delivering a gene editing substance to the T cell to shear TRAC and B2M genes; and cloning the targeted CD19 CAR and B2M-HLA-E fusion gene into a repair template vector to simultaneously introduce targeted CD19 CAR and B2M-HLA-E fusion gene homologous recombination repair templates into T cells. The universal targeted CD19 antigen chimeric receptorT cell has the advantages of small allograft rejection reaction, high yield, high safety, immediate availability, wide application range and the like.
Owner:西安桑尼赛尔生物医药有限公司

Optical system for generating approximate diffraction-free zero-order Mathieu beam

InactiveCN103760673AHigh Optical Damage ThresholdLarge clear apertureOptical elementsLight beamOptoelectronics
The invention discloses an optical system for generating an approximate diffraction-free zero-order Mathieu beam. The optical system for generating the approximate diffraction-free zero-order Mathieu beam comprises an optical platform, a laser device is arranged on the optical platform, and a cylindrical lens, a short focal length lens, a long focal length lens and an axicon are arranged along the light path of the laser device, wherein the short focal length lens is arranged nearby the focus of the cylindrical lens, and the focus of the short focal length lens and the focus of the long focal length lens are overlapped. The optical system can generate the approximate diffraction-free zero-order Mathieu beam, and provides a simple and effective new approach for obtaining the zero-order Mathieu beam. The beam can be applied to the fields of laser material processing, collimation measurement, optical wireless communication and the like.
Owner:HUAQIAO UNIVERSITY

Methylene bridging 1,8-naphthyridine ligand and copper (I) complex, preparing method and application

The invention discloses a methylene bridging 1,8-naphthyridine ligand and copper (I) complex, a preparing method and an application. The molecular formula of the methylene bridging 1,8-naphthyridine ligand and copper (I) complex is shown in the specification, wherein R1 is hydrogen or methyl. The methylene bridging 1,8-naphthyridine ligand and copper (I) complex is the first complex obtained in the mode that an activation reaction is carried out through a SP3C-H key under the condition that a catalyst is free so far, and it is firstly achieved that a C-C key is activated and constructed through the catalyst-free SP3C-H key. The copper (I) complex can be used as a catalyst of a coupling reaction between aryl halide and imidazole compound C-N, and the yield is high.
Owner:HONGHE COLLEGE

Augmented reality subtitle glasses for simultaneous translation

PendingCN109696748ASolve the inconvenience of communicationEfficient waySpeech recognitionTeaching apparatusMicrocontrollerIdentity recognition
The invention relates to a pair of augmented reality subtitle glasses for simultaneous translation, which is provided with the equipment such as a voice receiving module, a voice / text conversion module, an embedded microcontroller, a memory, an identity recognition module, a text input module, a text / voice conversion module, a voice output module and a display screen, and is characterized in thatthe mutual conversion between voice and texts is realized through the voice / text conversion module and the text / voice conversion module in the AR glasses, the simultaneous translation between different languages is realized through a translation module, text information is presented on the display screen of the AR glasses as subtitles, and a user A and a glasses wearer can know what the opposite side expresses through browsing the subtitles on the display screen or directly listen to the voice broadcast. the problem of inconvenient communication between different types of people is effectivelysolved through the augmented reality subtitle glasses for simultaneous translation, thereby not only providing a good way for the deaf to return to the normal life and reintegrate into the society, but also being capable of realizing the simultaneous translation between Chinese and foreign languages.
Owner:郑州诚优成电子科技有限公司

Intelligent library management and reading design method

The invention discloses an intelligent library management and reading design method. The method comprises: (1), designing intelligent library management terminal equipment to provide an overall library management system and flow including book information recording and storage as well as book tag generation and scanning so as to provide intelligent and convenient library management equipment for library management for a librarian; (2), designing two-dimensional-code-based book tags and pasting the tags in a standardized manner, thereby saving time for library management work and book borrowing work and thus improving the efficiency; and (3), designing a library management and reading method and providing an intelligent, convenient, and efficient management and reading method for the librarian and borrowers.
Owner:JIANGSU UNIV

Method and system for evaluating surface state of wire of power transmission line

The invention relates to a method for evaluating the surface state of a wire of a power transmission line. The method comprises the following steps of: detecting the surface roughness of the wire; and determining the aging degree of the wire according to the surface roughness of the wire. Compared with the prior art, the method has the advantages that the aging degree of the wire is determined by detecting the surface roughness of the wire, the evaluation efficiency and accuracy of the surface face of the wire are greatly improved, and a convenient, efficient and accurate way is provided for evaluation of the operating situation of the wire and management of the service life of the line in long-term operation. The invention also relates to a system for evaluating the surface state of the wire of the power transmission line.
Owner:JIANGMEN POWER SUPPLY BUREAU OF GUANGDONG POWER GRID +1

CFD-based heavy metal wastewater sulfuration precipitation reactor optimization method

The invention discloses a CFD-based heavy metal wastewater sulfuration precipitation reactor optimization method. The method comprises the following steps: establishing a fluid computational domain geometric model of a sulfuration precipitation reactor; according to the established geometric model, determining a control equation and defining a boundary condition and an initial value of the model according to an actual situation and a design thought; meshing the geometric model of the sulfuration precipitation reactor, and solving flow field and reaction substance concentration distribution and the like of the model by using multi-physical field coupling; by modifying related parameters, repeating the process, performing multiple numerical simulation calculations, and comparing and analyzing calculation results under different geometric structures and technological parameters to obtain the optimal reactor structure and technological parameters. According to the invention, simulation calculation can be carried out on the sulfuration precipitation process under different reactor structures and process parameters to obtain results such as inlet and outlet water concentrations of the reactor, flow field distribution characteristics in the reactor, concentration distribution of each substance and the like so as to evaluate the reactor performance under different conditions.
Owner:CENT SOUTH UNIV

Superparamagnetism-plasma composite microsphere and preparation method thereof

ActiveCN108236932AExcellent plasma optical effectAnd tunable plasmonic optical effectsOther chemical processesAlkali metal oxides/hydroxidesNanometreBrown iron oxide
The invention relates to a superparamagnetism-plasma composite microsphere and a preparation method thereof and particularly discloses the preparation method of the superparamagnetism-plasma compositemicrosphere. The preparation method comprises the following steps: (1) synthesizing a polydopamine microsphere, (2) synthesizing a superparamagnetism microsphere, (3) carrying out surface activationon the superparamagnetism microsphere, (4) growing gold seeds on the surface of the superparamagnetism microsphere, and (5) growing a gold nano-shell on the surface of the superparamagnetism microsphere. The superparamagnetism-plasma composite microsphere provided by the invention contains a core of the polydopamine microsphere, wherein the core is loaded with iron oxide particles growing in situand the iron oxide particles are externally coated with dopamine ligands and a gold nanoparticle shell grown in an in situ nucleation manner. The superparamagnetism-plasma composite microsphere is capable of realizing rapid superparamagnetism response and has excellent and tunable plasma optical effects; and the preparation method is simple, convenient and feasible and convenient to repeat and popularize.
Owner:SHENZHEN INST OF ADVANCED TECH

Pear transcription factor PbrMYB169 and application thereof

The invention discloses a pear transcription factor PbrMYB169 and an application thereof. The pear transcription factor PbrMYB169 is separated from Dangshan crisp pears, and has MYB family member PbrMYB169 genes capable of adjusting and controlling development of sclereid of pear fruits, the nucleotide sequence of the pear transcription factor PbrMYB169 is as shown in SEQID No.1, and the coding amino acid sequence of the pear transcription factor PbrMYB169 is as shown in a sequence table SEQID No.2. Through an agrobacterium tumefaciens mediated heredity conversion method, PbrMYB169 transcription factors are converted into arabidopsis thaliana, and transgenic plants are obtained; biological function verification indicates that the PbrMYB169 gene cloned through the pear transcription factorPbrMYB169 has the function of promoting synthesis of arabidopsis thaliana inflorescence stem lignin, besides, the PbrMYB169 transcription factor has the advantage of being capable of adjusting and controlling a plurality of genes, and an efficient way is provided for molecular breeding. New genetic resources are provided for reduction of molecular breeding of synthesis of organism lignin, new heredity resources are provided for implementing green agriculture, and reduction of the agriculture cost and realization of an environmental-friendly purpose can be facilitated through development and utilization of the heredity resources.
Owner:NANJING AGRICULTURAL UNIVERSITY

Water-rich round-gravel stratum shield muck improvement method and muck improvement agent

The invention discloses a muck improvement agent which comprises liquid A and liquid B. The liquid A comprises, by weight, 0.25-0.33 parts of sodium bentonite, 0.01-0.015 part of carboxymethylcellulose and 1 part of water. The liquid B comprises, by weight, 0.001-0.003 part of polyacrylamide and 1 part of water. The invention further discloses a method for improving water-rich round-gravel stratumshield muck by the muck improvement agent. According to the muck improvement agent, the liquid A with the volume injection ratio of 30%, the liquid B with the volume injection ratio of 7.5% and soilsamples from an on-site water-rich round-gravel stratum are stirred and mixed, the collapsing degree can be controlled within 20cm, a permeability coefficient K of improvement soil reaches 1*10<-7>m / sunder water pressure of 2.5bar (25m water head), continuous time reaches 4 hours or more, the permeability coefficient is smaller than 1*10<-5>m / s serving as a flowing critical value, and improvementeffects are good.
Owner:CHINA RAILWAY DEV INVESTMENT CO LTD +2

Ball-rolling type ocean wave generator

The invention provides a ball-rolling type ocean wave generator. The ball-rolling type ocean wave generator comprises a floating boat, hinges are arranged at the two ends of the floating boat, and a balance plate, a steel ball, a steel ball rolling groove, gear racks, gear rack guide rails, a driving gear, one-way ratchet wheels, variable gears, flywheels, generator bodies, a limiting pillar, balance plate supports, shaft supports and a bottom plate are arranged in the floating boat. The floating boat is a sealed structure body, and the two generator bodies are arranged inside the floating boat. The floating boat can be fixed to the seabed or a ship or other floating objects through one rope. Along with waving of ocean waves, the steel ball rolls along the steel ball rolling groove, and the balance plate rotates accordingly to drive the gear racks to move vertically so that the driving gear can rotate to drive the generator bodies to generate power. The ball-rolling type ocean wave generator has the advantages of being simple in structure, reliable in performance, high in efficiency, free of pollution, easy to arrange and popularize, small in investment, rapid in reward and the like.
Owner:NANJING MEIXUE POWER TECH

Projection Moire gear tooth surface three-dimensional measurement device and measurement method

InactiveCN111189408ASolve the occlusion problem of non-contact measurement of shape errorEasy to interfereUsing optical meansPoint lightGrating
The invention relates to a projection Moire gear tooth surface three-dimensional measurement device and measurement method. The device comprises a point light source, a measuring grating and a semi-reflection semi-transmission mirror are sequentially arranged on a light path of the point light source, an included angle of 45 degrees is formed between the semi-reflection semi-transmission mirror and the light path, and a lens, a reference grating and an industrial camera are sequentially arranged on a reflection light path by which the point light source passes through the semi-reflection semi-transmission mirror. The point light source is composed of an optical fiber support, optical fiber and a light source, one end of the optical fiber is connected to an emission end of the light source,and the other end is erected on the optical fiber support. According to the invention, a light path propagation path is changed through the semi-reflection semi-transmission mirror, compared with theuse of a reflecting mirror, the reflecting mirror needs to be installed in a tooth groove, the fixation is complex, interference with the measurement device easily occurs, while the semi-reflection semi-transmission mirror can be installed outside a tooth groove of a measured gear, the structure is simpler, the implementation is easy, meanwhile, optimal projection and data acquisition can also berealized, and the measurement is free of light shielding.
Owner:XIAN TECHNOLOGICAL UNIV

Pear fruit stone cell phenotype detection method based on computer image processing

The invention discloses a pear fruit stone cell phenotype detection method based on computer image processing. The pear fruit stone cell phenotype detection method comprises the following steps: acquiring a pear fruit section image dyed by phloroglucinol hydrochloride, modulating parameters of the image into a gray value image, segmenting and extracting an image contour by using a threshold value,and counting the number, size and area of stone cells in the image. According to the invention, the number of stone cells can be analyzed; the size and the area of stone cells and the section area ofpear fruits can be analyzed; compared with a traditional hydrochloric acid freezing separation method and an enzymolysis method, the method has the advantages that the working efficiency during stonecell trait measurement is improved, statistical data of stone cell traits is enriched, errors and research cost of manual measurement are reduced, and the method has far-reaching significance in peargermplasm evaluation and breeding.
Owner:NANJING AGRICULTURAL UNIVERSITY

SSR (simple sequence repeat) marker for cucumber leaf color mutant genes v-1 and application thereof

The invention discloses an SSR (simple sequence repeat) marker for cucumber leaf color mutant genes v-1 and an application thereof, relating to a plant breeding assistive technology. The nucleotide sequence of a primer of the SSR marker which is closely linked with the cucumber leaf color mutant genes v-1 is as follows: SSR8v-1-F / SSR8v-1-R: GGCAATGGTAAAGGTTGGAA / AAGGGATGTGTGGTGTGGTT; a characteristic strip of the SSR marker linked with the leaf color mutant genes v-1, which is amplified by the primer, is 194bp, and the nucleotide sequence is as shown in Seq ID No. 1; the characteristic strip of the SSR marker linked with leaf green genes V-1, which is amplified by the primer, is 206bp, and the nucleotide sequence is as shown in Seq ID No. 2. By adopting the SSR marker obtained according to the invention, the leaf color mutant genes v-1 can be screened in any stage against plant materials; the SSR marker has the advantages of high efficiency, few limitations and accuracy, and can improve the selection efficiency and accuracy of breeding plant high-light efficiency yellow leaf materials and also provide a simple, convenient and efficient way for assisted breeding of high-light efficiency breeding materials by utilizing the SSR marker which is co-segregated from leaf color control genes.
Owner:INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI

Resin composite material with abnormal sound prevention function and preparation method thereof

The invention belongs to the technical field of composite materials, and particularly relates to a resin composite material with an abnormal sound prevention function suitable for air conditioner parts and a preparation method thereof. The resin composite material comprises the following raw material components in parts by weight: 5-30 parts of compound PPO, 5-30 parts of PP, 20-70 parts of PS, 1-5 parts of a paraffin-based graft copolymer, 5-10 parts of a compatilizer, 2-5 parts of a flexibilizer, 1-5 parts of a plasticizer, 0.3-0.6 part of an antioxidant, 0.5-1.0 part of a lubricant, 1.5-2.5parts of LLDPE, 0.5-2.0 parts of a slipping agent, 2-4 parts of a viscosity reducer and 0.5-2.0 parts of an acid acceptor. The material can reduce the vibration frequency of a workpiece after injection molding so that the purpose of reducing the abnormal sound of the plastic part is achieved, the problem of friction abnormal sound of the air conditioner part is solved from the aspect of materials, the effect is remarkable, the mode is simple and the use prospect is good.
Owner:青岛海纳新材料有限公司

Method for increasing cycle conversion utilization of Zoysia japonica high frequency regeneration series

The invention discloses a method for increasing cycle conversion utilization of Zoysia japonica high frequency regeneration series. The method uses the Zoysia japonica high frequency regeneration callus series for performing gene transformation, the Zoysia japonica high frequency regeneration callus series can be used to obtain the regeneration plant stem for performing gene transformation, a regeneration method for the Zoysia japonica regeneration plant stem and a culture medium. The method provided in the invention provides a high efficiency approach for the cycle utilization and gene transformation of the Zoysia japonica high frequency regeneration series, and has wide application prospect on the research and production field of the Zoysia japonica.
Owner:BEIJING AGRO BIOTECH RES CENT

Molecular marker closely linked to peach weeping gene and application of molecular marker

The invention discloses a molecular marker closely linked to the peach weeping gene and application thereof the molecular marker, and is expected to be applied to an assistant selection of a peach weeping molecular marker and the breeding of an excellent peach germplasm resource. Through the invention, an SNP molecular marker closely linked to the peach weeping gene is screened and obtained, including WESNP-20.83 and WESNP 20.99, wherein the WESNP-20.83 is located at 20.839 Mb of peach genome Pp03, and the nucleotide of the WESNP-20.83 is G or C; the WESNP-20.99 is located at 20.998 Mb of thepeach genome Pp03, and the nucleotide of the WESNP-20.99 is C or T; and an InDel marker WEInDel-21.61 closely linked to a weeping gene is further obtained. The invention provides a method for assisting in screening of the excellent peach germplasm resource based on developed molecular marker primers; molecular identification and screening of peach weeping traits in an early stage can be realized.The method has the advantages of high efficiency, less restriction and high accuracy.
Owner:ZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI

Method for improving full-section muck in silt soil layer during construction of contact channel pipe jacking machine

PendingCN113775345AChange the permeability coefficientNot easy to gushSilicon compoundsTunnelsSoil sciencePolymer solution
The invention relates to a method for improving full-section muck in a silt soil layer during construction of a contact channel pipe jacking machine. The method comprises the following steps of: S1, determining a muck improver; S2, performing an indoor test; S3, mixing the muck improver on site; and S4, performing site construction. The method has the beneficial effects that the muck is improved by adopting a bentonite improver (a bentonite solution and a high-molecular flocculant), a high-molecular polymer solution has relatively high adhesion and can well absorb soil moisture, and the permeability coefficient of the muck is changed through cutter head cutting and screw machine stirring, so that the muck is fully improved. The improved muck is not easy to gush and cake, the permeability of the muck in a soil bin is effectively reduced, and the gushing is further inhibited, so that shield tunneling is smooth and efficient, the shutdown time is shortened, the muck in a screw machine is prevented from being solidified, and the construction safety and smoothness are guaranteed.
Owner:浙江杭海城际铁路有限公司 +2

Formaldehyde monitoring and processing integrated equipment and formaldehyde processing method

InactiveCN106178927AConvenient and quick formaldehyde detection and treatmentGood processing effectProgramme controlComputer controlEnvironmental resistanceProcess engineering
The invention provides formaldehyde monitoring and processing integrated equipment. The formaldehyde monitoring and processing integrated equipment comprises a formaldehyde detection module, a signal adjusting and amplification circuit electrically connected with the formaldehyde detection module, a control module electrically connected with the signal adjusting and amplification circuit, and a display module and a gas processing apparatus electrically connected with the control module, wherein the gas processing apparatus comprises an air pump electrically connected with the control module, a water tank connected with the air pump, and a gas distributor arranged at an outlet of the air pump and positioned in the water tank. The invention also provides a formaldehyde processing method based on the formaldehyde monitoring and processing integrated equipment. The formaldehyde monitoring and processing integrated equipment and the formaldehyde processing method can simultaneously perform formaldehyde monitoring and performing corresponding treatment according to the monitoring condition, and have the advantages of good formaldehyde processing effect, high efficiency, no pollution, safety, and environmental protection.
Owner:宁波高新区绿邦科技发展有限公司

Multi-session binding method, device and system

The invention discloses a multi-session binding method, device and system. The method comprises that a user terminal receives PCRF related information which is distributed by a PGW when the user terminal establishes a first IP-CAN session of a Gx interface; and the user terminal sends an invitation message, which carries the PCRF related information, to an AF, and the AF is thus indicated to set PCRF as a target host for authenticating application messages when the user terminal establishes the session of the Rx interface.
Owner:ZTE CORP
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More