Clone, expression and biological activity of stingray caudal spine cyclophilin A gene
A technology in the amino acid and sequence table, applied in the direction of sugar derivatives, biochemical equipment and methods, microbe determination/testing, etc., to achieve high application prospects and industrial development value
Image
Examples
Embodiment 1
[0048] Example 1 Extraction, library construction and PCR clone screening of red ray tail thorn total RNA
[0049] Extraction of total RNA and synthesis of cDNA: Dissect the tail spines of two red stingrays, extract the total RNA of the tentacles by the guanidine isothiocyanate method, and remove the protein by phenol / chloroform extraction. Obtain 65 μg of tail spines total RNA, the A 260 / A 280 =1.98, two clear bands of 28s and 18s can be seen through 1% formaldehyde denaturing gel electrophoresis, the ratio>2, and mRNA smear (see figure 1 ), indicating that the integrity of total RNA was good. Perform first-strand synthesis, LD PCR cDNA amplification, enzyme digestion and column recovery of cDNA, and construct a cDNA library.
[0050] Primer design and PCR amplification: According to the cyclophilin (CyP) EST3' end and the carrier nucleotide sequence obtained from the random sequencing results of a small number of clones in the library, design primers, T7 primer: 5'-TAATA...
Embodiment 2
[0051] Example 2 Determination and analysis of recombinant red sting sting CypA gene sequence
[0052] The recovered electrophoresis products were connected to the T-easy vector, transformed into DH5α Escherichia coli, and the recombinant clones were selected for sequencing. A total of 12 clones were determined, and Blast homology analysis showed that 7 of them were cyclophilin A gene sequences. The length of the cyclophilin A gene is 656bp, encoding a penicillin protein with a length of 167 amino acids, numbered Ch120. Its nucleotide sequence similarity with human homologues is as high as 84%; it also has 72% homology with the reported CyPA protein sequence but is not completely identical. It has not been reported in red ray, and it is a new cyclophilin A protein.
[0053] Use the tool software DNAtools to analyze its base sequence (as shown in the figure above), and obtain its maximum reading frame. The start codon ATG appears near the 5' end, and a characteristic Okazaki i...
Embodiment 3
[0082] Example 3 Construction of recombinant red ray sting cyclophilin A protein expression plasmid
[0083] A pair of primers were synthesized according to the two ends of the cyclophilin A gene of the red ray stingray, and a KpnI restriction site (GGTACC), ATG initiation codon, and a Prescission Protease cleavage site were introduced into the upstream primer, and a Prescission Protease cleavage site was introduced into the downstream primer Introduce BamH I restriction site (GGATCC) and stop codon TTA, TCA.
[0084] Upstream primer (P1): 5'-GG GGTACC CTGGAAGTTCTGTTCCAAGGTCCA ATG
[0085] Kpn I Precision Protease site
[0086] GCCAACAAGAAGCCCA-3'
[0087] Downstream primer (P2): 5'-CG GGATCC TTA TCA GGACAACTCCCACAAT-3'
[0088] Bam H I
[0089] The DGEM-T easy plasmid containing the cyclophilin A gene was used as a template, and P1 and P2 were used as primers for PCR amplification to obtain a specific...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- IPC
- C07H21/04; C07K14/435; C12P19/34; C12P21/02; C12N15/64; C12N15/70; C12Q1/18; C12Q1/10
- Inventors
- 徐安龙; 涂洪斌
