Clone, expression and biological activity of stingray caudal spine cyclophilin A gene

A technology in the amino acid and sequence table, applied in the direction of sugar derivatives, biochemical equipment and methods, microbe determination/testing, etc., to achieve high application prospects and industrial development value

A technology in the amino acid and sequence table, applied in the direction of sugar derivatives, biochemical equipment and methods, microbe determination/testing, etc., to achieve high application prospects and industrial development value

CN100509837CInactive Publication Date: 2009-07-08北京博奥环宇生物技术有限公司

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Clone, expression and biological activity of stingray caudal spine cyclophilin A gene
  • Clone, expression and biological activity of stingray caudal spine cyclophilin A gene
  • Clone, expression and biological activity of stingray caudal spine cyclophilin A gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 Extraction, library construction and PCR clone screening of red ray tail thorn total RNA

[0049] Extraction of total RNA and synthesis of cDNA: Dissect the tail spines of two red stingrays, extract the total RNA of the tentacles by the guanidine isothiocyanate method, and remove the protein by phenol / chloroform extraction. Obtain 65 μg of tail spines total RNA, the A 260 / A 280 =1.98, two clear bands of 28s and 18s can be seen through 1% formaldehyde denaturing gel electrophoresis, the ratio>2, and mRNA smear (see figure 1 ), indicating that the integrity of total RNA was good. Perform first-strand synthesis, LD PCR cDNA amplification, enzyme digestion and column recovery of cDNA, and construct a cDNA library.

[0050] Primer design and PCR amplification: According to the cyclophilin (CyP) EST3' end and the carrier nucleotide sequence obtained from the random sequencing results of a small number of clones in the library, design primers, T7 primer: 5'-TAATA...

Embodiment 2

[0051] Example 2 Determination and analysis of recombinant red sting sting CypA gene sequence

[0052] The recovered electrophoresis products were connected to the T-easy vector, transformed into DH5α Escherichia coli, and the recombinant clones were selected for sequencing. A total of 12 clones were determined, and Blast homology analysis showed that 7 of them were cyclophilin A gene sequences. The length of the cyclophilin A gene is 656bp, encoding a penicillin protein with a length of 167 amino acids, numbered Ch120. Its nucleotide sequence similarity with human homologues is as high as 84%; it also has 72% homology with the reported CyPA protein sequence but is not completely identical. It has not been reported in red ray, and it is a new cyclophilin A protein.

[0053] Use the tool software DNAtools to analyze its base sequence (as shown in the figure above), and obtain its maximum reading frame. The start codon ATG appears near the 5' end, and a characteristic Okazaki i...

Embodiment 3

[0082] Example 3 Construction of recombinant red ray sting cyclophilin A protein expression plasmid

[0083] A pair of primers were synthesized according to the two ends of the cyclophilin A gene of the red ray stingray, and a KpnI restriction site (GGTACC), ATG initiation codon, and a Prescission Protease cleavage site were introduced into the upstream primer, and a Prescission Protease cleavage site was introduced into the downstream primer Introduce BamH I restriction site (GGATCC) and stop codon TTA, TCA.

[0084] Upstream primer (P1): 5'-GG GGTACC CTGGAAGTTCTGTTCCAAGGTCCA ATG

[0085] Kpn I Precision Protease site

[0086] GCCAACAAGAAGCCCA-3'

[0087] Downstream primer (P2): 5'-CG GGATCC TTA TCA GGACAACTCCCACAAT-3'

[0088] Bam H I

[0089] The DGEM-T easy plasmid containing the cyclophilin A gene was used as a template, and P1 and P2 were used as primers for PCR amplification to obtain a specific...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The present invention constructs red ray (Dasytis akajei) tail thorn cDNA library and DNA sequencing, and according to the obtained cyclophilin (CyP) EST 3' end and carrier nucleotide sequence, designs primers, uses the method of PCR, from The full-length cyclophilin A gene was screened and cloned from the red ray sting cDNA library. The length of the new gene is 656bp, and it encodes a mature peptide of 167 amino acids. The expressed protein has an isoelectric point of 8.34 and a molecular weight of about 18,021 Daltons. The red stingray thorn cyclophilin A gene was cloned at the 3' end of the trxA gene of the thioredoxin gene fusion expression vector pTRX, and a fusion gene in line with the reading frame was constructed. The fusion protein was soluble in E. coli as an intracellular Form exists, the expression amount can reach 60mg / L. Through Ni-Chelating affinity chromatography, protease 3C cleavage and gel filtration, the mature recombinant red ray cyclophilin A protein with a purity of more than 95% was obtained, with a yield of 10 mg / L. The protein has peptidylproline cis-trans isomerase activity.

Description

technical field [0001] The invention relates to the cloning, expression and biological activity of the red ray tail thorn cyclophilin A (cyclophilin A) gene. More specifically, the present invention relates to starting from the total plasmid of the cDNA expression library of the red stingray stingray, using the PCR method to screen and clone the full-length CypA gene, and using the method of genetic engineering to express and purify the CypA gene with biological activity in a high-efficiency Escherichia coli expression system. The red ray tail sting cyclophilin A protein, through the identification of peptidyl proline cis-trans isomerase activity of the recombinant red ray cyclophilin A protein and the research on the binding affinity with cyclosporine A (CsA), etc., Confirm its activity, and use it as a drug target to screen small molecular compounds and traditional Chinese medicine components that can bind to it with high affinity, laying the foundation for the screening of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
08 Jul 2009
Publication
CN100509837C
IPC
C07H21/04; C07K14/435; C12P19/34; C12P21/02; C12N15/64; C12N15/70; C12Q1/18; C12Q1/10
Inventors
徐安龙; 涂洪斌