Glutathione produced bacterial strain and construction method thereof

A technique for producing glutathione and bacterial strains, which is applied in the field of genetic engineering, can solve problems such as the inability to purposefully regulate cell expression, achieve high cell density, biotransformation rate, high bioaccumulation, and reduce synthetic production costs Effect

Inactive Publication Date: 2008-07-16
南京华锦生物制品有限公司
View PDF6 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the general method of genetic engineering or metabolic engineering is to add foreign genes or the host's own genes, which generally change the original regulatory promoter or still use the original gene promoter but change the copy number, because GSH I and GSH II have not been studied in depth The proportional rela

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Glutathione produced bacterial strain and construction method thereof
  • Glutathione produced bacterial strain and construction method thereof
  • Glutathione produced bacterial strain and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0045] Example 1: Construction of recombinant GSH-related synthetase expression pAOG1G2 plasmid (schematic diagram 1)

[0046] 1. Extraction of Saccharomyces cerevisiae genomic DNA

[0047] Extract the genomic DNA of Saccharomyces cerevisiae according to the "Yeast Genetics Method Experimental Guide". Inoculate S. cerevisiae S288c in 4ml YPD medium (1% yeast extract, 2% peptone, 2% glucose) at 28-30°C for 16-18 hours. Centrifuge the culture medium to settle the cells (3000rpm, 10min), then wash with cold, equal volume of sterile distilled water and centrifuge, transfer the cell pellet to a 1.5ml centrifuge tube, and place it in 200μl lysis buffer (2%(v / v) Triton X-100, 1% (v / v) SDS, 100 mM NaCl, 10 mM Tris base (pH 8.0), 1 mM EDTA (pH 8.0)) was resuspended, and then approximately 300 μl of acid-washed glass beads and 200 μl of 1:1 phenol:chloroform mixture, vortex and shake for 1-2 min, add 200 μl of TE buffer (10 mM Tris base (pH 8.0), 1 mM EDTA (pH 8.0)), invert and mix 6-10 tim...

Example Embodiment

[0062] Example 2: Construction of CYS3 and CYS4 gene expression vectors

[0063] 1. Extraction of the genome of the host strain Pichia pastoris GS115

[0064] The method is the same as the extraction of Saccharomyces cerevisiae genomic DNA in Example 1.

[0065] 2. Cloning of G418 resistance gene and CBS gene

[0066] The upstream and downstream primers were designed according to the plasmid pPIC3.5K, the upstream primer (5'sense primer) pkan-1TGAGGGAGCCACGGTTGATGAGAGC, and the downstream primer (3'anti-sense primer) pkan-2GGGGTGTTATGAGCCATATTCAACG.

[0067] Using plasmid pPIC3.5K as a template and the above primer pair as primers, Pyrobest polymerase was used to amplify the Kan fragment derived from the E. coli transposon Tn903 G418 resistance gene.

[0068] According to the GS115 strain genome CBS gene (GenBank No.AF367364) design upstream and downstream primers, upstream primer (5'sense primer) pCBS-1 AGAAATACATACTATGTCAGACAACAACC, downstream primer (3'anti-sense primer) pCBS-2...

Example Embodiment

[0083] Example 3: Construction of recombinant cells expressing exogenous cystathionine synthase and cystathionine-γ-lyase genes

[0084] 1. Preparation for electroporation of Pichia pastoris cells

[0085] The GS115 strain was inoculated into 2ml YPD medium, cultivated at 30°C for 12-20 hours, inoculated into 100ml YPD medium at a ratio of 1:100, and cultivated at 30°C to OD 600 =1.3~1.5, 4℃, 1500g centrifugation for 10min, the precipitate was washed twice with pre-cooled sterile water suspension, 4℃, 1500g centrifugation for 10min, and then with pre-cooled 1mol / L D-sorbitol suspension to wash the pellet twice, After centrifugation at 1500g for 10 minutes at 4°C, the obtained GS115 was resuspended in 0.3ml of pre-cooled 1mol / LD-sorbitol and placed on ice for later use.

[0086]2. Construction of recombinant cells expressing exogenous cystathionine synthase and cystathionine-γ-lyase genes

[0087] Use the PCR product gel recovery kit to extract about 3-4 small amounts of the above-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a glutathione producing strain, in which a GSH related synthetic enzyme Gamma-L-glutamyl-L-cysteine synthetic enzyme gene GSH I, a glutathione synthetic enzyme gene GSH II, and a cysteine related synthetic enzyme cystathionine synthetic enzyme gene CYS3 and a cystathionine-Gamma-lyase CYS4 gene are introduced. The glutathione producing strain of the invention has the advantages of high density and low cost.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a glutathione-producing bacterial strain and a construction method thereof. Background technique [0002] Glutathione (GSH) is an important non-protein sulfhydryl compound in organisms. Due to its many important physiological functions, it is not only widely used in the fields of medicine and cosmetics, but also widely used in various food processing. Fields, such as flavored food, dairy products, oral health products, etc. [Sies H. (1999) Free Rad Biol Med.27, 916-921; Zheng Yunlang (1995) Biological Bulletin 30, 22-24]. The industrial production of glutathione is mainly chemical synthesis, enzymatic and biological fermentation. Optical activity and environmental problems in chemical methods. There are two main ways to biosynthesize GSH: enzymatic conversion and fermentation. The common feature of the two is that there must first be a microorganism with good performance, an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/19C12N15/52C12N15/60C12N15/81C07K5/083C12R1/84
Inventor 许善峰金大勇蔡宇杰
Owner 南京华锦生物制品有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap