Recombination expression and application of shrimp antimicrobial peptide genes in probiotic bacteria

A technology of antimicrobial peptides and probiotics, applied in application, genetic engineering, plant gene improvement, etc., can solve the problems of antimicrobial peptide gene transfer, etc., to promote the production of antibodies, improve immunity and disease resistance, and improve activity Effect

Inactive Publication Date: 2008-12-03
上海汉德食品有限公司
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] But at present, there is no transfer of antimicrobial peptide genes into probiotics

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombination expression and application of shrimp antimicrobial peptide genes in probiotic bacteria
  • Recombination expression and application of shrimp antimicrobial peptide genes in probiotic bacteria
  • Recombination expression and application of shrimp antimicrobial peptide genes in probiotic bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Construction of Escherichia coli pET28a Expression Vector Containing Grass Shrimp Antimicrobial Peptide Gene

[0050] 1) Establishment of grass shrimp cDNA library

[0051] Take 20 grass shrimps, homogenate, extract with extract (4M guanidine thiocyanate, 25mM sodium citrate, 0.5% laurylsarcosinate, 0.1M mercaptoethanol), extract total RNA with guanidinium salt-phenol-chloroform method, and construct total cDNA library.

[0052] 2) Clone the grass shrimp penaeidin-4 gene by PCR method

[0053] According to the gene sequence of Penaeidin-4 of Litopenaeus vannamei and Litopenaeus setiferus, specific primers Pen4MF1 / Pen4MR1 were designed, and Nde I and Hind III restriction sites were added to both ends of the primers to amplify the penaeidin-4 gene. The primer sequence is:

[0054] Pen4MF1 5'ATCATATGAGCAGCGGTTACACGCG 3'

[0055] Pen4MR1 5'CCAAGCTTTATCCTCTGTGACAACA 3'

[0056] The PCR reaction volume was 50ul, and the amplification conditions were: 94°C for 2min; 30 cyc...

Embodiment 2

[0061] Recombination and expression of the antimicrobial peptide gene of grass shrimp in yeast

[0062] 1) Establishment of grass shrimp cDNA library

[0063] Take 20 grass shrimps, homogenate, extract with extract (4M guanidine thiocyanate, 25mM sodium citrate, 0.5% laurylsarcosinate, 0.1M mercaptoethanol), extract total RNA with guanidinium salt-phenol-chloroform method, and construct total cDNA library;

[0064] 2) Clone the grass shrimp penaeidin-4 gene by PCR method

[0065] According to the gene sequence of Penaeidin-4 of Litopenaeus vannamei and Litopenaeus setiferus, specific primers Pen4MF2 / Pen4MR2 were designed, and EcoR I and Not I restriction sites were added to both ends of the primer to amplify the penaeidin-4 gene. The primer sequence is:

[0066] Pen4MF2 5' ATGGATCC ATGAGCAGCGGTTACACGCG 3'

[0067] Pen4MR2 5'CCAAGCTTCTATCCTCTGTGACAACA 3'

[0068] The PCR reaction volume was 50ul, and the amplification conditions were: 94°C for 2min; 30 cycles of 94°C for ...

Embodiment 3

[0078] Recombination and expression of grass-containing shrimp antimicrobial peptide gene in lactic acid bacteria

[0079] The penaeidin-4 gene was amplified by PCR using the penaeidin-4 gene-specific primers Pen4MF3 / Pen4MR3 with pMD-Pen4-position template and Sac I and Kpn I restriction sites at both ends.

[0080] The primer sequences are:

[0081] Pen4MF3 5' ATGAGCTC ATGAGCAGCGGTTACACGCG 3'

[0082] Pen4MR3 5' CCGGTACCCTATCCCTCTGTGACAACA 3'

[0083] The PCR reaction volume was 50ul, and the amplification conditions were: 94°C for 2min; 30 cycles of 94°C for 30s, 51°C for 45s, and 72°C for 45s; 72°C for 10min.

[0084] Approximately amplified products were detected by 2% agarose gel electrophoresis. The obtained product was purified with a gel purification kit, and connected with the T-vector pMD18T to obtain the cloning vector pMD-Pen4-3 containing the target gene.

[0085] Use Kpn I / Sac I double enzymes to digest pMD-Pen4-3 and lactic acid bacteria expression plasmid...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a recombinant expression of shrimp antibacterial peptide in probiotic bacteria and an application thereof, which comprises the clone of a shrimp antibacterial peptide gene, the construction of the recombinant carrier of the shrimp antibacterial peptide gene, the conversion and the screening of the recombinant carrier of the shrimp antibacterial peptide gene, the engineering bacteria of the fermentation culture expressed antibacterial peptide, and the verification and the purification of an expression product. The invention also provides the application of recombining probiotic bacteria with the shrimp antibacterial peptide gene. The probiotic bacteria which is used for aquaculture feed, in particular to feed chiefly used for shrimps. The recombinant probiotic bacteria can continually propagate in an organism body, is expressed continually within a certain period, is provided for the antibacterial peptide of the organism body, and has good specificity and validity.

Description

technical field [0001] The invention relates to biological gene recombination engineering, in particular to the recombination expression and application of shrimp antibacterial peptide gene in probiotics. Background technique [0002] Since the approval of antibiotics as feed additives in the 1940s, it has played a huge role in promoting the development of animal husbandry. However, with the popularization and application of antibiotics in feed, their side effects have gradually become prominent. The first is the problem of drug resistance of bacteria; the second is that the abuse of antibiotics not only increases the cost of feed, but also causes the decline of animal immune function, the imbalance of flora in the body, the occurrence of endogenous infection or superinfection, and the increase in death; the third is livestock and poultry products The problem of drug residues in the drug, and cause toxicity to the ecological environment. In order to avoid global environment...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/09C12N15/12C12P21/02A23K1/16A23K10/18A23K50/80
Inventor范立强江帆袁勤生
Owner上海汉德食品有限公司