Molecular marker closely linked with salt-tolerant main effect QTL (Quantitative Trait Loci) at tomato seedling stage and application thereof

A molecular marker, tomato seedling technology, applied in the field of agricultural biology, can solve the problems of slow progress of tomato salt tolerance breeding, complex tomato salt tolerance genetic mechanism, long breeding cycle, etc., so as to improve the accuracy of selection and breeding efficiency, improve the Breeding and selection efficiency, production cost savings

Inactive Publication Date: 2011-02-16
HORTICULTURE INST OF XINJIANG ACAD OF AGRI SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The genetic mechanism of tomato salt tolerance is complex; in conventional breeding practice, it is very difficult to select salt-tolerant materials: on the one hand, the breeding cycle is long, and complex selection procedures of hybridization and backcrossing are required; on the other hand, the occurrence of salt damage is affected by The combined effect of many factors, such as: air temperature, air humidity and soil water content, etc., makes the process of identifying salt-tolerant materials difficult to control
These are important reasons for the slow progress of tomato salt-tolerant breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker closely linked with salt-tolerant main effect QTL (Quantitative Trait Loci) at tomato seedling stage and application thereof
  • Molecular marker closely linked with salt-tolerant main effect QTL (Quantitative Trait Loci) at tomato seedling stage and application thereof
  • Molecular marker closely linked with salt-tolerant main effect QTL (Quantitative Trait Loci) at tomato seedling stage and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1: Acquisition of Molecular Markers Tightly Linked to Salt Tolerance Major QTL in Tomato Seedling Stage

[0052] (1) F 1 mongrel.

[0053] (2)F 1 Selfing produces 1338 F 2 Individual plants, the genomic DNA of each F2 individual plant was isolated, and 1338 F2 strains were screened using the flanking marker SSR285 on the salt-tolerant subintrogression line IL7-5-5. 2 single plant, a 255-strain F 2 Regroup.

[0054] (3) According to existing methods (Song Jian, Journal of Shanghai Jiaotong University (Agricultural Science Edition), 2006, 24(6): 524-528; Wu Yuhui, China Agricultural Science Bulletin, 2008, 24(4): 80-84; Lei Na, Journal of Northeast Agricultural University, 2008, 39(3): 29-33), isolated the DNA of parental IL7-5-5 and M82, and used microsatellite (SSR), enzyme-cut amplified polymorphic sequence (CAPS) and Amplified fragment length polymorphism (AFLP) primers were used to perform PCR amplification on the two parents, and the amplified products...

Embodiment 2

[0065] According to the existing technology, adopt: Song Jian, Journal of Shanghai Jiaotong University (Agricultural Science Edition), 2006, 24(6): 524-528; Wu Yuhui, China Agricultural Science Bulletin, 2008, 24(4): 80-84; Lei Na , Journal of Northeast Agricultural University, 2008, 39(3): 29-33, selecting primer combinations of SSR, CAPS and AFLP with amplified polymorphism between the two parents IL7-5-5 and M82. After PCR amplification, the amplified products were separated by electrophoresis on 1.5% agarose gel and 6% denaturing polyacrylamide gel, and the polymorphic markers obtained were respectively SSR primers SSR285, CAPS Mark U231219 and C 2 - At4g30580, AFLP markers E35 / M49 and E39 / M50.

[0066] The primer sequences used were:

[0067] The upstream primer of SSR285 is 5'AGTGGCTCTCACCTACTGCG'3, and the downstream primer is 5'CAATTCTCAGGCATGAAACG'3;

[0068] The upstream primer of U231219 is 5'AGTCTCTTGCTTGAGTCTGGAGTTG'3, and the downstream primer is 5'TGCTGGGAATA...

Embodiment 3

[0073] Example 3: Molecular markers closely linked to main effect QTL for salt tolerance in tomato seedling stage are in F 2 Validation in segregated populations

[0074] The obtained molecular markers closely linked to the major QTL for salt tolerance in tomato seedling stage were found in the F 2 Part of the plants of the first generation were predicted for seedling salt tolerance. DNA was isolated from their leaves, and then the DNA was amplified by PCR using primers labeled SSR285, C2_At4g30580, U231219, E35 / M49 and E39 / M50, and passed Judging the map to determine whether there are corresponding markers, if there are more than 3 molecular markers on the opposite side of the main QTL for salt tolerance, it means that the line belongs to the salt-tolerant line at the seedling stage, and if it does not exist, it is a salt-sensitive material. Then based on these judgment criteria, the seedling salt tolerance of each tomato plant was predicted. Subsequently, the actual salt t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an acquisition method of a molecular marker closely linked with salt-tolerant main effect QTL (Quantitative Trait Loci) at the tomato seedling stage, comprising the following steps of: positioning by the salt-tolerant main effect QTL at the tomato seedling stage; selecting M82 at the tomato seedling state and a salt-tolerant introgressed line IL7-5 to hybridize to obtain ahybrid F1 for self-pollination to obtain a group F2; screening a polymorphism molecular marker between a salt-tolerant sub-introgressed line 7-5-5 and a salt-sensitive variety M82 by the salt stress processing; screening the F2 group by using the screened side wing marker on the IL7-5-5 and establishing a recombinant F2 group and genetic analysis; and determining the molecular marker closely linked with salt-tolerant main effect QTL at the tomato seedling stage by the salt-tolerant survival rate and the marker detection in a genetic linkage map. The invention is not influenced by environment conditions, can be used for screening progeny and derivative strains of the salt-tolerant materials at the specific seedling stage at early generation, saves the cost and improves the breeding and selecting efficiency.

Description

field of invention [0001] The invention relates to the field of agricultural biotechnology. Specifically, the present invention relates to the technical field of a molecular marker closely linked to a main effect QTL (Quantitative Tratit Loci, Quantitative Tratit Loci) of tomato seedling salt tolerance, its obtaining method and application. Background technique [0002] Tomato (Solanum lycopersicum) belongs to Solanaceae tomato genus, widely cultivated all over the world, not only can be used for fresh food, but also can be processed into different types of tomato products. However, with the increase of the multiple cropping index, the application of water, fertilizer, pesticides, especially long-term nitrogen fertilizer has increased significantly, and secondary salinization has appeared in varying degrees in both open field and protected land, which seriously affects the normal growth of tomato. Growth and Development (Li Tingxuan, Southwest Agricultural Journal, 2001, 14...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/10
Inventor王柏柯余庆辉杨生保帕提古丽杨涛
OwnerHORTICULTURE INST OF XINJIANG ACAD OF AGRI SCI