Method for improving transformation efficiency of (S)-phenyl glycol by coupling glucose-6-phosphate dehydrogenase and (S)-carbonyl reductase
A technology of phenylethylene glycol and construction method, which is applied in the field of coupling of 6-phosphate glucose dehydrogenase and (S)-carbonyl reductase to improve the conversion efficiency of (S)-phenylethylene glycol, and can solve the problem of substrate Problems such as low concentration, expensive coenzyme, and low optical purity of the product
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0067] Cultivation of Candida parapsilosis and Saccharomyces cerevisiae.
[0068] Candida parapsilosis medium composition: glucose 4%, yeast extract 0.5%, (NH4) 2 HPO 4 1.3%, KH 2 PO 4 0.7%, ZnSO 4 ·7H 2 O 0.03%, NaCl 0.01%, pH7.0. The strain CCTCC NO: M 203011 was inoculated into a 250 mL shake flask with 50 mL medium, and cultured at 30°C and 150 rpm for 48 h with shaking.
[0069] Saccharomyces cerevisiae medium composition: tryptone 1%, yeast extract 0.5%, NaCl 1%, glucose 1%, pH 7.0; Saccharomyces cerevisiae strains were inoculated in 250 mL shake flasks with 20% medium volume in Shake culture at 30°C and 150 rpm for 48 hours.
Embodiment 2
[0071] Obtaining the genomes of Candida parapsilosis and Saccharomyces cerevisiae: After the cultivation of Candida parapsilosis and Saccharomyces cerevisiae, the cells were centrifuged at 6,000 g for 20 min, washed twice with normal saline, and the cells were collected. Genomic DNA Extraction Kit Genomic DNA Extraction Miniprep System extracts Candida parapsilosis genome and Saccharomyces cerevisiae genome.
Embodiment 3
[0073] scr Acquisition of the II gene. Using the Candida parapsilosis genome as a template, using the Bam Primer SCRⅡ_pPIC3.5K_F containing H I restriction site and not The primer SCRⅡ_pPIC3.5K_R of the I restriction site was used to obtain the full length of the SCRⅡ gene by PCR.
[0074] SCRⅡ_pPIC3.5K_F: CG GGATCC ACCATGGGCCATCATCATCATCATCA TAGCAGTGGCATGGGCGAAATCGAATC ( Bam H I)
[0075] SCRⅡ_pPIC3.5K_R: TT GCGGCCGC CTATGGACAAGTGTAACCACCATC GAC ( not I)
[0076] PCR reaction system: 10×Taq buffer 5 μL, 25 mmol / L dNTP 4 μL, 50 pmol / μL primers SCRⅡ_pPIC3.5K_F and SCRⅡ_pPIC3.5K_R 1 μL each, Candida parapsilosis DNA 5 μL, 5 U / μL Taq DNA polymerase 0.5 μL, ddH 2 O 33.5 μL, total reaction volume 50 μL. PCR reaction conditions: pre-denaturation at 95°C for 4 min; 30 cycles of 94°C for 1 min, 58°C for 1 min, and 72°C for 1 min; extension at 72°C for 10 min. get scr II gene fragment.
PUM
| Property | Measurement | Unit |
|---|---|---|
| electrical resistance | aaaaa | aaaaa |
| optical purity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 