Method for improving transformation efficiency of (S)-phenyl glycol by coupling glucose-6-phosphate dehydrogenase and (S)-carbonyl reductase

A technology of phenylethylene glycol and construction method, which is applied in the field of coupling of 6-phosphate glucose dehydrogenase and (S)-carbonyl reductase to improve the conversion efficiency of (S)-phenylethylene glycol, and can solve the problem of substrate Problems such as low concentration, expensive coenzyme, and low optical purity of the product

Active Publication Date: 2011-03-30
JIANGNAN UNIV
View PDF1 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Optically pure ( S )-phenylethylene glycol, usually using microbial whole cells or enzymes as catalysts, using different chemical reaction pathways, such as Bakers' yeast asymmetric reduction of 2-hydroxyacetophenone method, epoxide hydrolase catalyzed hydrolysis racemization Styrene oxidation method, and naphthalene dioxygenase (NDO) selective styrene oxidation method, etc., these methods have the disadvantages of low substrate concentration, expensive coenzyme, and low optical purity of the product
In the asymmetric reduction reaction catalyzed by oxidoreductase, the inability to recycle the coenzyme is the "bottleneck" factor that limits its industrial application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Cultivation of Candida parapsilosis and Saccharomyces cerevisiae.

[0068] Candida parapsilosis medium composition: glucose 4%, yeast extract 0.5%, (NH4) 2 HPO 4 1.3%, KH 2 PO 4 0.7%, ZnSO 4 ·7H 2 O 0.03%, NaCl 0.01%, pH7.0. The strain CCTCC NO: M 203011 was inoculated into a 250 mL shake flask with 50 mL medium, and cultured at 30°C and 150 rpm for 48 h with shaking.

[0069] Saccharomyces cerevisiae medium composition: tryptone 1%, yeast extract 0.5%, NaCl 1%, glucose 1%, pH 7.0; Saccharomyces cerevisiae strains were inoculated in 250 mL shake flasks with 20% medium volume in Shake culture at 30°C and 150 rpm for 48 hours.

Embodiment 2

[0071] Obtaining the genomes of Candida parapsilosis and Saccharomyces cerevisiae: After the cultivation of Candida parapsilosis and Saccharomyces cerevisiae, the cells were centrifuged at 6,000 g for 20 min, washed twice with normal saline, and the cells were collected. Genomic DNA Extraction Kit Genomic DNA Extraction Miniprep System extracts Candida parapsilosis genome and Saccharomyces cerevisiae genome.

Embodiment 3

[0073] scr Acquisition of the II gene. Using the Candida parapsilosis genome as a template, using the Bam Primer SCRⅡ_pPIC3.5K_F containing H I restriction site and not The primer SCRⅡ_pPIC3.5K_R of the I restriction site was used to obtain the full length of the SCRⅡ gene by PCR.

[0074] SCRⅡ_pPIC3.5K_F: CG GGATCC ACCATGGGCCATCATCATCATCATCA TAGCAGTGGCATGGGCGAAATCGAATC ( Bam H I)

[0075] SCRⅡ_pPIC3.5K_R: TT GCGGCCGC CTATGGACAAGTGTAACCACCATC GAC ( not I)

[0076] PCR reaction system: 10×Taq buffer 5 μL, 25 mmol / L dNTP 4 μL, 50 pmol / μL primers SCRⅡ_pPIC3.5K_F and SCRⅡ_pPIC3.5K_R 1 μL each, Candida parapsilosis DNA 5 μL, 5 U / μL Taq DNA polymerase 0.5 μL, ddH 2 O 33.5 μL, total reaction volume 50 μL. PCR reaction conditions: pre-denaturation at 95°C for 4 min; 30 cycles of 94°C for 1 min, 58°C for 1 min, and 72°C for 1 min; extension at 72°C for 10 min. get scr II gene fragment.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
electrical resistanceaaaaaaaaaa
optical purityaaaaaaaaaa
Login to View More

Abstract

The invention relates to a method for improving the transformation efficiency of (S)-phenyl glycol by coupling glucose-6-phosphate dehydrogenase and (S)-carbonyl reductase, belonging to the technical field of biological catalytic asymmetric transformation. The invention provides the method for preparing the (S)-phenyl glycol by recombinant Pichia pastoris with CGMCCNo.4198 and 2-hydroxyacetophenone catalyzed by the recombinant Pichia pastoris with CGMCCNo.4198 in multiple batches. In the invention, the Saccharomyces cerevisiae glucose-6-phosphate dehydrogenase gene and the Candida parapsilosis (S)-carbonyl reductase gene are simultaneously integrated into the Pichia pastoris genome, under the participation of 5% (w / v) glucose, the whole cells are reused for 10 batches, and the optical purity and yield of the (S)-phenyl glycol prepared by asymmetric transformation are maintained at 100% and higher than 85% all the time. The recombinant strain improves the batch stability of full cell transformation of the (S)-phenyl glycol by polygene coexpression, which well relieves the limit of coenzyme regenerative cycle in a biological transformation reaction; and simultaneously an efficient approach for preparing the (S)-phenyl glycol industrially in multiple batches at low cost is provided.

Description

technical field [0001] Glucose 6-phosphate dehydrogenase and ( S )-carbonyl reductase coupling improves ( S )-Phenylglycol conversion efficiency method, using gene co-expression to improve whole cell asymmetric conversion ( S The efficiency of )-phenyl glycol and the method for batch stability, the present invention relates to utilizing the means of genetic engineering, constructed ( S )-carbonyl reductase (SCRⅡ) and 6-phosphate glucose dehydrogenase (G6PDH) co-expressed recombinant Pichia pastoris ( Pichia pastoris ) SCRⅡG, efficient preparation ( S )-phenyl glycol belongs to the technical field of biocatalytic asymmetric transformation. Background technique [0002] Optically pure phenylethylene glycol (PED) is an indispensable chiral additive in liquid crystal materials and an important intermediate in the preparation of optically active medicines, pesticides and functional materials. Optically pure ( S )-phenylethylene glycol, usually using microbial whole cells or...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/19C12N15/53C12N15/81C12P41/00C12P7/22C12R1/84
Inventor张荣珍徐岩张波涛耿亚维
OwnerJIANGNAN UNIV