Optimized triphenylmethane reductase gene as well as expression and application thereof

A technology of triphenylmethane and reductase, applied in the field of phytoremediation, to achieve the effect of less environmental pollution

Inactive Publication Date: 2011-06-29
SHANGHAI ACAD OF AGRI SCI +1
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Compared with other organic pollutants, there is no report on the use of plants to degrade different types of dye pollutants in China.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Optimized triphenylmethane reductase gene as well as expression and application thereof
  • Optimized triphenylmethane reductase gene as well as expression and application thereof
  • Optimized triphenylmethane reductase gene as well as expression and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] De novo synthesis of an optimized triphenylmethane reductase gene following the plant-preferred code

[0065] We re-synthesized the optimized triphenylmethane reductase gene according to the plant-preferred code, and compared the newly synthesized gene sequence with the original gene sequence ( figure 1 ). The optimized triphenylmethane reductase gene synthesis primers are as follows:

[0066] P1 ATGGCTATCGCTGTCACTGGTGCTACTGGTCAACTCGGTGGTCTTGTCATCCAACACTTTGCT

[0067] P2 TTACGAACGATGGCAATGATCTGAGAGGCAGGGACCTTCTTCAGCAAAGTGTTGGATGACAAGA

[0068] P3 AGATCATTGCCATCGTTCGTAACGTCGAGAAAGCCTTCCACTCTTGCTGATCAAGGTGTCGAA

[0069] P4 CTGAAAGAGACTCAGGTTGATTGTAGTCACCATGACGAACTTCGACACCTTGATCAGCAAG

[0070] P5 AACCTGAGTCTCTTTCAGAAGGCTTTCGCTGGTGTCTCCAAGCTGCTCTTCATCTCTGGTCCTCA

[0071] P6 CGACGTTAGCATGTTGGACGATCAGCAGAGTGTATGTCGTAGTGAGGACCAGAGATGAAGAGCAG

[0072] P7 CGTCCAACATGCTAACGTCGTCAAGGCTGCTCGTGATGCTGGTGCATAGCACATCGCTTACAC

[0073] P8 TGAGCAAGTGGAATGATGGATTCCCTCAGCGAAAGCGTAACC...

Embodiment 2

[0089] Construction of optimized plant expression vector for triphenylmethane reductase gene

[0090] The triphenylmethane reductase from Citrobacter was modified according to the plant-preferred code, and the gene was re-synthesized by gene synthesis method (Xiong 2004, Nucleic Acid Research).

[0091] Respectively use BamHI and SacI to carry out double enzyme digestion, recover the DNA fragments, connect the optimized triphenylmethane reductase gene with the pYPX245 plasmid containing double 35S promoters by T4 DNA ligase, purify, identify by enzyme digestion and sequence determination to obtain triphenylmethane reductase gene The recombinant plasmid vector pYPXtmr of methane reductase gene ( figure 2 ). The expression vector also contains a GUS reporter gene and a kanamycin resistance marker gene with an intron.

Embodiment 3

[0093] Agrobacterium cultivation and plant transformation

[0094] Agrobacterium strains are Agrobacterium tumefaciens EHA105, LBA4404, GV3101 strains. The plasmid was introduced into Agrobacterium by electroporation. Pick a single bacterium and culture it overnight in 25ml YEB medium (50mg / L rifampicin), transfer 5ml of the bacterial solution to 100ml YEB medium (50mg / L rifampicin), and cultivate it until OD600=0.7-0.8. Place on ice for 10 minutes, centrifuge at 5000rpm for 10min at 4°C, collect the bacteria, add 100ml sterile double distilled water to wash twice. Add 4ml of 10% glycerol to suspend the bacteria and transfer to a 50ml centrifuge tube. Centrifuge at 5500rpm for 10min at 4°C. Collect the bacteria, add 500 μl of 10% glycerol to suspend the bacteria, and transfer to a 1.5ml centrifuge tube. Take 70 μl of competent cells and add 1 μl of recombinant plasmid vector pYPXtmr. Mix well with a yellow pipette tip with the head removed, and transfer to a 0.1cm electri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an optimized triphenylmethane reductase gene as well as an expression and an application thereof. The triphenylmethane reductase gene in citric acid bacillus is transformed by a plant preference codon to get the optimized triphenylmethane reductase gene with the full length of 864bp, the nucleotide sequence of the optimized triphenylmethane reductase gene is as shown in SEQ (sequence) ID (identity) No.1, and the sequence of a coded protein is as shown in SEQ ID No.2. The optimized triphenylmethane reductase gene is constructed into a plant vector, agrobacterium-mediated transformation is further performed, and a transformed arabidopsis thaliana plant can continuously express triphenylmethane reductase and induce the plant to participate in degradation of crystal violet and malachite green, thereby providing broad application prospects for restoring pollution caused by triphenylmethane dyes through the plant.

Description

technical field [0001] The invention belongs to the field of phytoremediation, and in particular relates to an optimized triphenylmethane reductase gene and its expression and application. Background technique [0002] Triphenylmethane dyes (Triphenylmethane dyes) are a class of polybenzene ring compounds. It is the third largest dye used after azo and anthraquinone dyes. It is used in textile printing and dyeing, food, medicine, paper, cosmetics, leather, etc. It is widely used in industrial and biological tissue staining. Such dyes and intermediate degradation products are potentially toxic and mutagenic, and have strong teratogenic, carcinogenic, and mutagenic effects. A large amount of waste water is produced in the process of production and use. This kind of waste water is dark in color, difficult to biodegrade, and seriously pollutes the environment. [0003] Triphenylmethane dye compounds and intermediate metabolites enter the environment along with production, tran...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/53C12N9/02C12N15/82A62D3/02C12R1/01A62D101/26
Inventor付晓燕姚泉洪彭日荷熊爱生赵伟田永生高峰朱波
OwnerSHANGHAI ACAD OF AGRI SCI