Snailflower citric acid transporter gene VuMATE and use thereof

A technology of citric acid and transporter, applied in application, genetic engineering, plant genetic improvement and other directions, can solve the problems of difficulty in obtaining economic and ecological benefits, destroying soil structure, reducing bioavailability, etc., and improving the secretion of citric acid. , major application prospects, the effect of improving the resistance of aluminum

Inactive Publication Date: 2011-08-17
ZHEJIANG UNIV
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the application of lime and fertilizer can reduce or prevent the aluminum poisoning of topsoil, it is difficult and uneconomical to apply lime or fertilizer to the bottom soil, and these measures need to invest a lot of manpower, material and financial resources, and long-term application will also damage the soil. structure, which reduces the bioavailability of trace elements such as Zn and Fe, making it difficult to obtain good economic and ecological benefits

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Snailflower citric acid transporter gene VuMATE and use thereof
  • Snailflower citric acid transporter gene VuMATE and use thereof
  • Snailflower citric acid transporter gene VuMATE and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Embodiment 1, the cloning of rice bean citrate transporter gene:

[0055] Soak the surface-sterilized rice bean seeds in deionized water overnight, wrap them with moist gauze and place them in a dark room at 25°C to germinate them. 2 (pH4.5) solution grows in the dark on the net basket, puts it under light conditions when the root length is about 3cm, and transfers the net basket to 0.5mMCaCl containing 25μM Al when the root length grows to 4-5cm 2 (pH4.5) solution, after 12 hours of treatment, a 1 cm root tip was cut with a clean blade for RNA extraction. Use Oligod(T) 18 The cDNA synthesized by reverse transcription for the primers serves as a template for subsequent homologous cloning. Oligo d(T) 18 It is a known technology, and the specific sequence is 18 consecutive Ts.

[0056] According to the known citrate transporter genes (SbMATE, HvMATE1, AtMATE) in sorghum, barley, Arabidopsis and the possible citrate transporter genes (LaMATE, GmA1Tsb1, MtMATE, Os10g02...

Embodiment 2

[0063] Embodiment 2, the construction of constitutive expression transgene vector:

[0064] Binary vector pCAMBIA2300 ( figure 1 ) is a plant transgenic vector mediated by Agrobacterium, and there is a complete selection marker gene expression cassette in the vector, that is, the kanamycin resistance gene driven by the 35S promoter. There is a multiple cloning site (pUC18 MCS) for gene cloning upstream of the 35S promoter. In this experiment, the cauliflower mosaic virus constitutive promoter CaMV35S, green fluorescent protein GFP and pear ribulose-1,5-bisphosphate carboxylase / plus Oxygenase gene terminator nos, get the transformed pCAMBIA2300 vector. The rice bean citrate transporter gene VuMATE was forward inserted between the CaMV35S promoter and the green fluorescent protein GFP of the transformed pCAMBIA2300 vector to obtain the transgenic vector pRBM( figure 2 ). The primers for the VuMATE sequence used for transgenesis are: VuMATE-TF: CGGGGTACCTTAATGGAAGAGAATGG and...

Embodiment 3

[0065] Embodiment 3, tomato transformation:

[0066] The binary transgene vector pRBM was transformed into the Agrobacterium tumefaciens strain EHA105 by electroporation to obtain the EHA105 strain containing the binary plasmid vector, and the EHA105 strain containing the binary plasmid vector was used to transform tomato. Specifically:

[0067] Disinfect the ripe tomato seeds, soak them in sterile water and shake them on a shaker until they are white, and then sow them on 1 / 2 MS medium. When the cotyledons are fully unfolded and the true leaves are just exposed, cut off the tip and base of the cotyledons. Cut into 0.5cm 2 The small pieces were placed on the pre-medium with the off-axis side down and pre-cultured for 2 days at 25°C in the dark, and they were used as transformed receptors. Infect tomato leaf discs with strain EHA105 containing a binary plasmid vector, culture for 3 days in the dark at 25°C, and obtain resistance after selection on selection medium containing ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a snailflower citric acid transporter gene VuMATE, which has a nucleotide sequence represented by SEQ ID No.1. The invention also discloses a method for breeding an aluminum-tolerance transgenic crop, which comprises the following steps: 1) selecting the snailflower citric acid transporter gene VuMATE having the nucleotide sequence represented by SEQ ID No.1; 2) constructing a constitutive type expression transgenic vector; and 3) and breeding the transgenic crop, namely infecting leaf disc of tomatoes Micro-Tom with Agrobacterium rhizogenes EHA105 into which the pseudo-rigid-body model (pRBM) vector is transferred, co-culturing the transgenic plant, selecting, differentiating and rooting to obtain transgenic tomatoes MATE-2. The snailflower citric acid transporter gene VuMATE disclosed by the invention can be used for plant transgenosis for improving the aluminum tolerance of the crop.

Description

technical field [0001] The invention belongs to the fields of plant genetic engineering and crop breeding, in particular to the cloning of a citric acid transporter gene and a novel tomato transgenic material; specifically, to rice bean (Vigna umbellata) citric acid transporter (MATE) gene The cloning and application of the transgenic tomato grown after overexpressing this gene in improving aluminum tolerance in acidic soil. Background technique [0002] Soil acidity is a widespread and serious agricultural production problem worldwide, affecting crop production on 40% of the world's arable land [1] . Plants growing in acidic soils will encounter a series of abiotic stresses, such as the lack of nutrients such as nitrogen, phosphorus, and potassium, drought, and the poisoning of aluminum and manganese. And because aluminum can quickly damage the root tip, which can cause obstacles to the plant's nutrient and water absorption [2] This makes aluminum toxicity the most impor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/63A01H4/00A01H5/00
Inventor郑绍建杨建立杨晓颖
OwnerZHEJIANG UNIV