Method for producing 2-keto-L-gulonic acid vitamin C precursor by modifying Escherichia coli

A technology of Escherichia coli and 2-KLG, which is applied in the field of genetic engineering, can solve the problems of complex process, high energy and material consumption, and few varieties of product innovation, and achieve the effect of simple process and simple construction method

Active Publication Date: 2013-10-16
JIANGNAN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the two-step fermentation process currently used in domestic vitamin C industrial production has the advantages of short production cycle and low cost, there are also some problems at the same time, such as: (1) high energy and material consumption and high cost; (2) waste gas, The discharge of waste water and waste residue is large; (3) The process is complicated and the product innovation is less, which restricts the further development of the vitamin C industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] The construction of embodiment 1 expression vector

[0019] Design primers P1: 5'GGAATTCCATATGATGAAACCGACTTCGCTGCTTTGGGC3'; P2: 5'CCCAAGCTTTTATTGCGGCAGGGCGAAGACGTAGA3', clone the sdh / sndh gene sequence annotated in the whole genome sequencing results of K. vulgare DSM4205 and clone it into the plasmid pET28a(+) after amplification to construct the expression vector pET28a -sdh / sndh, after transforming the constructed expression vector into E.coli JM109, select the transformant, extract the plasmid and digest it with HindIII and NdeI, a 1740bp band appears, which proves that the expression vector pET28a-sdh / sndh; design primer P3: 5'CCCAAGCTTATGCCGAATACTTATGGCAGCAGAACCC3'P4: 5'ATAAGAATGCGGCCGCTCCAGCCCTTGTGATCAGGCAGTGC3', clone Gluconobacter oxydans ATCC 621H sldh gene sequence amplification and clone it into pET28a(+)-sdh / sndh, transform E.coli JM109, and select transformants After the plasmid was extracted and digested with HindIII and NotI, a 2612bp band appeared, whi...

Embodiment 2E

[0020] The construction of embodiment 2E.coli engineering bacteria

[0021] The finally constructed expression vector pET28a(+)-sdh / sndh-sldh-pqq was transformed into E.coli JM109. Due to the kanamycin resistance gene on the recombinant plasmid, transform E.coli JM109 competent, apply to LB containing kanamycin (yeast extract 5g / L, peptone 10g / L, NaCl 10g / L, solid Add 20g / L agar to the medium, adjust the pH to 7.0, and sterilize at 121°C for 15 minutes), pick the transformants that grew normally on the plate after transformation, and extract the plasmids for PCR verification. Bands of 1740bp, 2612bp, and 3187bp appeared respectively, and the control failed. The same band in PCR proved the successful transformation into E.coli, and then transformed the extracted plasmid into E.coli BL21 to obtain E.coli-pET28a-sdh / sndh-sldh-pqq engineering bacteria.

Embodiment 3

[0022] Embodiment 3 fermentation produces 2-KLG

[0023] Seed and slant medium (g / L): yeast extract 5, peptone 10, NaCl 10; agar 20 (slant medium), pH 7.0, sterilized at 121°C for 15 minutes, final concentration of kanamycin 50 μg / mL.

[0024] Fermentation medium (g / L): sorbose 80, peptone 12, yeast extract 24, glycerol 4ml, potassium dihydrogen phosphate 2.31, dipotassium hydrogen phosphate 12.54, pH 7.0, sterilized at 121°C for 15 minutes, kanamycin final The concentration is 50 μg / mL, and the final concentration of IPTG is 0.5 mM.

[0025] Culture conditions: Inoculate the recombinant bacteria from the slant into 20mL seed medium, inoculate the bacteria for 12 hours, inoculate the amount of 10%, fill the liquid with 10%; Shake flask fermentation was carried out at 30° C. and 220 rpm, and the fermentation period was 48 hours. Shake flask 2-KLG yield was 56g / L.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for transforming Escherichia coli to produce vitamin C precursor 2-keto-L-gulonic acid, which belongs to the field of genetic engineering. In the present invention, through genetic engineering technology, sorbitol dehydrogenase (SLDH), coenzyme pyrroloquinoline quinone (Pyrroloquinoline quinone, PQQ) gene cluster derived from Gluconobacter oxydans and common ketogenic gluconic acid The sorbose dehydrogenase (SDH) / sorbone dehydrogenase (SNDH) gene of Ketogulonigenium vulgare was expressed in Escherichia coli, and a strain of E.coli that utilizes sorbitol to produce 2-KLG was obtained. bacteria. At present, the two-step fermentation process used in the industrial production of vitamin C in China is complicated, with many influencing factors, and it is difficult to control accurately. At the same time, the growth of three kinds of microorganisms consumes a lot of raw materials and energy. E.coli engineering bacteria are used for fermentation production with sorbitol 2-KLG simplifies the production process, saves raw materials and energy, and the output of 2-KLG can reach 87g / L, which has a good application prospect.

Description

technical field [0001] The invention relates to a high-yield 2-KLG Escherichia coli engineering bacterium and a construction method thereof, which uses molecular means to introduce SLDH, SDH / SNDH and coenzyme PQQ, thereby realizing the production of 2-KLG by metabolizing sorbose, belonging to the field of genetic engineering. Background technique [0002] Vitamin C is an important organic acid widely used in industries such as pharmaceuticals, food, beverages, cosmetics and feed, and 2-KLG is an important precursor for the synthesis of vitamin C. At present, the industrialized production of vitamin C in China adopts a two-step fermentation method, and the two-step fermentation method with D-sorbitol as the substrate is the earliest and most studied production method. In this process, Gluconobacter oxydans converts D-sorbitol into L-sorbose, and L-sorbose into 2-keto-L-gulonic acid (2-keto-L-gulonic acid, 2-KLG) process is completed by a mixed bacteria system, which is compo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12N15/31C12N15/63C12P7/60C12R1/19
Inventor陈坚高丽丽周景文堵国成
OwnerJIANGNAN UNIV