Production of recombinant mixed isoamylases, alpha amylases and glucoamylases

A technology of glucoamylase and alpha amylase, applied in the biological field, can solve problems such as strains and mixed enzyme products that have not yet mixed expression enzymes, and achieve the effect of saving raw materials

Active Publication Date: 2011-12-21
INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI +1
View PDF1 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there are only single enzymes of these enzymes on the market, and there are no strains and mixed enzyme products that express these enzymes in combination

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Production of recombinant mixed isoamylases, alpha amylases and glucoamylases
  • Production of recombinant mixed isoamylases, alpha amylases and glucoamylases
  • Production of recombinant mixed isoamylases, alpha amylases and glucoamylases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1: Construction of Bacillus subtilis engineering bacteria to produce recombinant mixed isoamylase, α-amylase and glucoamylase

[0021] 1.1 Construction of Bacillus subtilis expression vector

[0022] 1.1.1 Construction of cloning vector

[0023] DNA synthesis contains ampicillin (AMP) gene sequence, polyclonal adapter and Escherichia coli replication origin, forming base complementarity at both ends of the sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. The cloning vector was named pBPA.

[0024] 1.1.2 Acquiring genes

[0025] ①PCR amplification of isoamylase gene

[0026] Genomic DNA of Pseudomonas amyloliquefaciens was extracted, and primers (5'CGGATATC GCCATCAACAGCATGAGC3'; 5'CGGATATCGGCTACTTGGAGATCAACAG3') were used for PCR amplification. The PCR product was sequence determined and analyzed with BLAST software provided by NCBI, which proved to be the sequence of the isoamylase gene.

[0027] ②PCR amplification of α...

Embodiment 2

[0089] 2.1 Construction of Pichia pastoris engineering bacteria

[0090] 2.1.1 Construction of cloning vector

[0091] DNA synthesis contains AMP gene sequence, polyclonal linker and E. coli replication origin: base complementation is formed at both ends of the sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. The cloning vector was named pPCA.

[0092] 2.1.2 Acquiring genes

[0093] ①PCR amplification of isoamylase gene

[0094] Genomic DNA of Pseudomonas amyloliquefaciens was extracted, and primers (5'CG GATATC GCCATCAACAGCATGAGC3'; 5'CG GATATC GGCTACTTGGAGATCAACAG3') were used for PCR amplification. The PCR product was sequenced and analyzed with BLAST software provided by NCBI, which proved to be isoamylase gene sequence.

[0095] ②PCR amplification of α-amylase gene (including signal peptide) of Bacillus licheniformis

[0096] Genomic DNA of Bacillus licheniformis was extracted, and primers (5'Atgaaacaacaaaaacggct3'; 5'ctatctttga...

Embodiment 3

[0157] 3.1 Construction of Saccharomyces cerevisiae engineering bacteria

[0158] 3.1.1 Construction of cloning vector

[0159] DNA synthesis contains AMP gene sequence, polyclonal linker and E. coli replication origin: base complementation is formed at both ends of the sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. The cloning vector was named pSCA.

[0160] 3.1.2 Acquiring genes

[0161] ①PCR amplification of isoamylase gene

[0162] Genomic DNA of Pseudomonas amyloliquefaciens was extracted, and primers (5'CG GATATC GCCATCAACAGCATGAGC3'; 5'CG GATATC GGCTACTTGGAGATCAACAG3') were used for PCR amplification. The PCR product was sequenced and analyzed with BLAST software provided by NCBI, which proved to be isoamylase gene sequence.

[0163] ②PCR amplification of α-amylase gene (including signal peptide) of Bacillus licheniformis

[0164] Genomic DNA of Bacillus licheniformis was extracted, and primers (5'Atgaaacaacaaaaacggct3'; 5'c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing the mixture of isoamylase, alpha-amylase and glucamylase and belongs to the field of biological technology. The method comprises: firstly, amplifying an isoamylase gene out of the genome of bacillus amyloliquefaciens, an alpha-amylase gene out of the genome of bacillus licheniformis, an alpha-amylase gene out of the genome of barley and a glucamylase gene out of the genome of aspergillus niger; secondly, constructing a bacillus subtilis expression vector containing the isoamylase gene, a pichia stipitis expression vector containing two alpha-amylase genes and a saccharomyces cerevisiae expression vector containing the glucamylase gene; thirdly, constructing engineering bacteria, namely transforming the genome of bacillus subtilis through the bacillus subtilis expression vector, transforming the genome of pichia stipitis through the pichia stipitis expression vector, and transforming the genome of the saccharomyces cerevisiae through the saccharomyces cerevisiae expression vector; and finally, allowing the fermentation engineering bacteria to produce the mixture of recombinant isoamylase, alpha-amylase and glucamylase. The mixed use of the enzymes can obviously improve the action under which starch can be hydrolyzed into glucose. The production of the mixed enzymes has the advantage that the change from the production of isoamylase, alpha-amylase and glucamylase by several steps regularly into production by one step obviously reduces energy consumption and lowers production cost.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to the construction of microbial engineering bacteria to produce recombinant proteins. Specifically, microbial engineering bacteria are used to produce recombinant mixed isoamylase, alpha amylase and glucoamylase. Background technique [0002] Starch must be hydrolyzed into glucose before it can be converted into ethanol. The human body cannot directly absorb starch, but it can directly absorb glucose. Every year, a large amount of isoamylase, α-amylase and glucoamylase need to be produced in the world to be used in industries such as caramel, wine making and food that convert starch into glucose. [0003] Starch consists of straight and branched chains. The branched chains are connected by α-1,6 glycosidic bonds, while the straight-chain sugar molecules are connected by α-1,4 glycosidic bonds. In natural starchy raw materials, the content of amylopectin accounts for about 70% to 95%, w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/34C12N9/28C12N9/26C12N15/75C12N15/81C12R1/125C12R1/84C12R1/865C12R1/38C12R1/10C12R1/685
Inventor张爱联罗进贤沈锦城张添元陈丽萍刘振旺张泽华易国辉
OwnerINST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI