Genetic engineering oral DNA vaccine and preparation method and application
A DNA vaccine and genetic engineering technology, applied in the direction of microorganism-based methods, biochemical equipment and methods, gene therapy, etc., can solve the problem of inability to transform wild-type strains
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1: Preparation of carp growth hormone mature peptide gene (GH).
[0046] (1) Extraction of carp growth hormone RNA:
[0047] Take two carp pituitary glands, follow RNeasy R The total RNA was extracted according to the operating instructions of the Kit, and the extracted total RNA was stored at -80°C for later use.
[0048] (2) Synthesis of the first strand of GH cDNA
[0049] According to the instructions of the Reverse Transcription System kit, with Oligo(dT) 20 Synthesize cDNA first strand for primers. The reaction system is as follows, sequentially add 12μl 25mM MgCl 2 6μl ReverseTranscription 10×Buffer; 6μl dNTP Mixture 10mM; 2μl Recombinant RNasinRibonuclease Inhibitor; 4μl AMV Reverse Transcriptase; 6μl Oligo(dT) 20 Primer; 15μl Total RNA was added to a PCR tube treated with DEPC water and sterilized. The reaction program was 42°C for 1 hour, 95°C for 5 minutes, and 4°C for 5 minutes. The product after the above reaction was placed at -20°C as a t...
Embodiment 2
[0052] Example 2: Preparation of fusion gene sgh.
[0053] PCR amplification of sgh gene: sgh was synthesized by PCR overlapping extension technique in 3 times. Using the pGEM-T-GH plasmid stored in the laboratory as a template, the upstream primer P3: 5_TTCGCCCTGGTCTGCCAAGGCATGGGGTCAGACAAC3_, the downstream primer P4: 5_GCG CTCGAG CTACAGGGTGCAGTTGGAATCCAGGGATCT3_ The underline is the XhoI site, the annealing temperature is 56°C, and the target fragment is amplified by PCR. PCR reaction system: 5μl 10×KOD Buffer; 2μl MgCl 2(25mM); 5μl dNTP Mixture (2.5mM); 1μl Upstream primer (25pmol); 1μl Downstream primer (25pmol); 1μl Template; 1μl Taq DNA Polymerase (1U / μl); add sterile water to a final volume of 50μl. The PCR reaction conditions of sgh gene were: 94°C for 30s, 56°C for 30s, 68°C for 1min (30 cycles), 68°C for 10min. The above PCR products were electrophoresed on agarose gel and recovered and purified. The specific steps are as follows: first electrophoresis the PCR pr...
Embodiment 3
[0054] Embodiment 3: subcloning construction
[0055] The pcDNA3.1(-) and purified sgh PCR products were double-digested with restriction endonucleases NheI and XhoI. The digestion system is as follows: sequentially add 30 μl pcDNA3.1(-) plasmid or purified PCR product; 4 μl 10×buffer2; 1 μl NheI; 1 μl XhoI; 2 μl ddH 2 O. The enzyme digestion reaction condition is 37°C, and the enzyme digestion time is 3-4 hours. The digested products were subjected to 1% (mass volume ratio) agarose gel electrophoresis, and the open-circle pcDNA3.1(-) and sgh PCR digested fragments were recovered with a gel recovery kit. The sgh PCR fragment was ligated with the open-circle pcDNA3.1(-). The ligation system was as follows: 2 μl open-circle pcDNA3.1(-); 6 μl sgh fragment; 1 μl 10×Ligation Buffer; 1 μl T4 DNA Ligase were added sequentially. The connection reaction system was connected in a 16°C water bath for 14-16 hours, and stored at -4°C for use.
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More