Soybean GmCOL5 gene and its coded protein and use
A protein and soybean technology, applied in the field of genetic engineering, can solve the problems of changing plant sensitivity and flowering time, and achieve the effect of promoting plant flowering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1 Cloning of Soybean Flowering Gene GmCOL5
[0024] Using the forward primer 5'-TAAACAGAAAGGCAACC-3' and the reverse primer 5'-CTAGAAAGTGGGAAAAATGCTAC-3' respectively, it was amplified from the leaves of soybean 'Kennong 18' (Glycine max L.'Kennong 18') by RT-PCR CO homologous gene.
[0025] The PCR reaction program was: 95°C 5min pre-denaturation, 95°C 30S, 50°C 35S, 72°C 2min, 25 cycles, 72°C 10min extension.
[0026] The amplified PCR product was cloned directly according to the TA cloning method into such as figure 2 on the indicated pGWCm vector. Firstly, the pGWCm vector was hydrolyzed with Ahd I endonuclease, and then the digested product was recovered with a gel recovery kit to obtain the T vector. Then the PCR product and the T vector were ligated overnight at 16°C, the ligated product was transformed into Escherichia coli DH5α, and amplified therein, positive clones were screened and sequenced.
[0027] The gene sequence of the obtained GmCOL5 gen...
Embodiment 2
[0028] Example 2 Amino Acid Sequence Analysis of Protein Encoded by Soybean Flowering Gene GmCOL5
[0029] The homology between the GmCOL5 protein sequence of the soybean flowering gene and Arabidopsis is 53.7%, and the sequence of the conserved functional domain (two B-boxes and one CCT domain) is highly homologous, such as figure 1 shown. Therefore, it is speculated that GmCOL5 has a similar function to Arabidopsis CO and has the activity of promoting plant flowering.
Embodiment 3
[0030] Example 3 Expression levels of soybean flowering gene GmCOL5 in different tissues and organs and different developmental stages in soybean
[0031] The expression of soybean flowering gene GmCOL5 in soybean was determined by quantitative real time RT-PCR. Real-time fluorescent quantitative PCR was carried out using ABI StepOne, and SYBR Green I was used to detect the fluorescent signal. Upstream primers:
[0032] 5'-GTGGTGATAAGGGTTTTTTGTTTG-3'; downstream primer: 5'AGTGTTGCTGTAATTCTGCTGGT 3'.
[0033] The reaction system is:
[0034] SYBR Primix Ex Taq(2×)(TaKaRa) 7.5μl
[0035] Upstream primer (10μM) 0.3μl
[0036] Downstream primer (10μM) 0.3μl
[0037] ROX Reference Dye (50x) 0.3μl
[0038] cDNA 1.0μl
[0039] Sterilized double distilled water 5.6μl
[0040] The reaction parameters are two-step method: 95°C 10S, hot start; 95°C 5S, 60°C 1min, 40 cycles. Gene expression was normalized and plotted using gene chip data analysis software Genesis.
[0041] The soy...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Upstream primer | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 