Unlock instant, AI-driven research and patent intelligence for your innovation.

Soybean GmCOL5 gene and its coded protein and use

A protein and soybean technology, applied in the field of genetic engineering, can solve the problems of changing plant sensitivity and flowering time, and achieve the effect of promoting plant flowering

Inactive Publication Date: 2012-04-04
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Changing plant sensitivity to photoperiod and flowering time by modulating soybean flowering gene expression has also not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Soybean GmCOL5 gene and its coded protein and use
  • Soybean GmCOL5 gene and its coded protein and use
  • Soybean GmCOL5 gene and its coded protein and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Cloning of Soybean Flowering Gene GmCOL5

[0024] Using the forward primer 5'-TAAACAGAAAGGCAACC-3' and the reverse primer 5'-CTAGAAAGTGGGAAAAATGCTAC-3' respectively, it was amplified from the leaves of soybean 'Kennong 18' (Glycine max L.'Kennong 18') by RT-PCR CO homologous gene.

[0025] The PCR reaction program was: 95°C 5min pre-denaturation, 95°C 30S, 50°C 35S, 72°C 2min, 25 cycles, 72°C 10min extension.

[0026] The amplified PCR product was cloned directly according to the TA cloning method into such as figure 2 on the indicated pGWCm vector. Firstly, the pGWCm vector was hydrolyzed with Ahd I endonuclease, and then the digested product was recovered with a gel recovery kit to obtain the T vector. Then the PCR product and the T vector were ligated overnight at 16°C, the ligated product was transformed into Escherichia coli DH5α, and amplified therein, positive clones were screened and sequenced.

[0027] The gene sequence of the obtained GmCOL5 gen...

Embodiment 2

[0028] Example 2 Amino Acid Sequence Analysis of Protein Encoded by Soybean Flowering Gene GmCOL5

[0029] The homology between the GmCOL5 protein sequence of the soybean flowering gene and Arabidopsis is 53.7%, and the sequence of the conserved functional domain (two B-boxes and one CCT domain) is highly homologous, such as figure 1 shown. Therefore, it is speculated that GmCOL5 has a similar function to Arabidopsis CO and has the activity of promoting plant flowering.

Embodiment 3

[0030] Example 3 Expression levels of soybean flowering gene GmCOL5 in different tissues and organs and different developmental stages in soybean

[0031] The expression of soybean flowering gene GmCOL5 in soybean was determined by quantitative real time RT-PCR. Real-time fluorescent quantitative PCR was carried out using ABI StepOne, and SYBR Green I was used to detect the fluorescent signal. Upstream primers:

[0032] 5'-GTGGTGATAAGGGTTTTTTGTTTG-3'; downstream primer: 5'AGTGTTGCTGTAATTCTGCTGGT 3'.

[0033] The reaction system is:

[0034] SYBR Primix Ex Taq(2×)(TaKaRa) 7.5μl

[0035] Upstream primer (10μM) 0.3μl

[0036] Downstream primer (10μM) 0.3μl

[0037] ROX Reference Dye (50x) 0.3μl

[0038] cDNA 1.0μl

[0039] Sterilized double distilled water 5.6μl

[0040] The reaction parameters are two-step method: 95°C 10S, hot start; 95°C 5S, 60°C 1min, 40 cycles. Gene expression was normalized and plotted using gene chip data analysis software Genesis.

[0041] The soy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Upstream primeraaaaaaaaaa
Login to View More

Abstract

The invention discloses a soybean GmCOL5 gene coded protein. The soybean GmCOL5 gene coded protein is a protein 1 composed of an amino acid sequence shown by the formula of SEQ ID NO.2, or a protein 2 which is derived from the protein 1 through replacement, deletion or addition of one or more amino acids of the amino acid sequence shown by the formula of SEQ ID NO.2 and has activity same as the protein 1. The invention also discloses a soybean GmCOL5 gene for coding the soybean GmCOL5 gene coded protein. Through overexpression of the soybean GmCOL5 gene, plant anthesis is obviously promoted; anthesis is brought forward; and a breeding period is shortened. In crossbreeding, the soybean GmCOL5 gene coded protein and the soybean GmCOL5 gene can solve flowering asynchronism problems, breeding period control problems of various crops, vegetables, fruits and flowers, photoperiodic sensitivity problems and introduction problems.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a soybean flowering gene, its encoded protein and its application in the regulation of plant photoperiod and flowering time. Background technique [0002] Soybean is one of the important crops, and it is an important source of plant protein, edible oil, biodiesel, and secondary metabolites such as isoflavones and lecithin. Because soybean is a short-day plant, flowering is strictly controlled by photoperiod, so excellent varieties in different regions cannot be introduced to each other, and the growth period is also restricted by environmental photoperiod (Zhang et al., 2008). If the sensitivity of soybean to photoperiod can be reduced, and the limitation of soybean flowering to photoperiod can be broken, the problem of soybean introduction can be solved, so as to realize the mutual exchange of high-quality varieties in various regions, enrich excellent germplasm resources in v...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21A01H5/00
Inventor 傅永福张晓玫
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI