Method for high-efficiency production of recombinant lipoxygenase by using Bacillus subtilis

A technology of lipoxygenase and Bacillus subtilis, which is applied in the field of high-efficiency production of recombinant lipoxygenase, can solve the problem that the complete removal of E. coli pyrogens cannot be guaranteed.

Inactive Publication Date: 2012-07-11
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Enzymes for food are bulk industrial products, and the downstream usually adopts low-cost separation and extraction methods, which cannot guarantee the complete removal of pyrogens such as E. coli; if complex purification methods are used, the cost becomes the limiting factor for application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for high-efficiency production of recombinant lipoxygenase by using Bacillus subtilis
  • Method for high-efficiency production of recombinant lipoxygenase by using Bacillus subtilis
  • Method for high-efficiency production of recombinant lipoxygenase by using Bacillus subtilis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Cloning of lipoxygenase gene from Anabaena sp. PCC 7120

[0032] Anabaena sp. PCC 7120 cells were collected by centrifugation, and the genomic DNA of Anabaena sp. was extracted with the Shanghai Sangon Genomic DNA Extraction Kit.

[0033] Two primers were designed according to the genome sequence published by NCBI:

[0034] Upstream primer: 5'GGAGTGTCTGGTGCC 3' (SEQ ID NO.12);

[0035] Downstream primer: 5'CTAAATGTTGATACTCATCAT3' (SEQ ID NO.13);

[0036]In a 50 μl system, the final concentration of upstream and downstream primers is 1 μM, the final concentration of dNTPs is 0.2 mM, 10 ng of Anabaena genomic DNA, and 2UPfu DNA polymerase. The amplification program was 94°C for 3min; 30×(94°C for 30s, 59°C for 50s, 72°C for 40s); 72°C for 10min. Agarose gel electrophoresis, gel cutting, recovery by Shanghai Sangon kit, connection of the recovered PCR product with TaKaRapMD19-T vector, transformation of E.coli DH5α, spreading on LB plates containing IPTG, X-ga...

Embodiment 2

[0037] Example 2 Construction of secreted expression vector pHBSR

[0038] 2.1 The acquisition of carrier pHB-hc ( figure 1 )

[0039] In order to construct a Bacillus subtilis expression vector that can secrete foreign protein products, the Escherichia coli / Bacillus subtilis shuttle vector pHB201 was selected as the backbone, which is a stable cloning vector, and its backbone was derived from the Bacillus subtilis vector pTA1060. The multiple cloning site is located in the fusion gene cat86::lacZα, and because it is not suitable for expression, its promoter P59, cat86::lacZα region can be excised ( figure 1 ).

[0040] A pair of primers P1 (SEQ ID NO.2) and P2 (SEQ ID NO.3) are designed so that they can be paired to form double strands, and the two ends form sticky ends of ClaI and XhoI. The reaction system is as follows:

[0041] In a 200 µL PCR thin-walled tube add:

[0042]

[0043]

[0044] After mixing, denature in a water bath at 94°C for 2 minutes, cool natu...

Embodiment 3

[0061] Example 3 Construction of Prokaryotic Expression Vector of Anabaena sp.PCC 7120 Lipoxygenase Gene

[0062] According to the obtained lipoxygenase gene sequence, design two primers, the upstream primer plus the SacI recognition sequence, and the downstream primer plus the XhoI recognition sequence:

[0063] Upstream primer 5'-CGCGAGCTCGGAGTGTCTGGTGCC-3' (SEQ ID NO.14)

[0064] Downstream primer 5'-CCGCTCGAGCTAAATGTTGATACTCATCAT-3' (SEQ ID NO.15)

[0065] Add components according to the following PCR system to amplify the LOX gene:

[0066]

[0067] The PCR program is 94°C 2min; 30×(94°C 45s; 58°C 50s; 72°C 4min); 72°C 10min.

[0068] Purify the PCR product with Shanghai Sangon PCR Product Purification Kit, add SacI, XhoI double enzyme digestion, inactivation, ethanol precipitation, ddH 2 O was redissolved, ligated with an appropriate amount of vector pHBSR digested with the same restriction enzyme, and transformed into E. coli DH5α. Randomly pick a few colonies fr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the food industry biotechnology field, and relates to a method for high-efficiency production of recombinant lipoxygenase by using Bacillus subtilis. The method comprises the following steps: (1) constructing Anabaena lipoxygenase recombinant Bacillus subtilis genetic engineering bacteria; (2) inoculating the Anabaena lipoxygenase recombinant Bacillus subtilis genetic engineering bacteria in a LB medium which possesses liquid volume of 58-63mL / 250mL and is filled with 15-18g / L lactose, cultivating at the conditions of 27-30 DEG C and 180rpm for 85-90h, centrifuging and collecting a supernatant. Under the best conditions, activity of the recombinant lipoxygenase can reach 167.32U / mL, and the method of the invention provides certain guidance for large-scale production of the recombinant lipoxygenase.

Description

technical field [0001] The invention belongs to the field of food industry biotechnology, and relates to a method for efficiently producing recombinant lipoxygenase by using Bacillus subtilis. Background technique [0002] Lipoxygenase (Lipoxygenase, EC1.13.11.12), referred to as lipoxygenase, is an oxidoreductase that can catalyze unsaturated fatty acids containing cis-cis-1,4-pentadiene structure (such as linoleic acid, flax acid, etc.) and esters to form hydroperoxides, and the generated unstable hydroperoxides can oxidize gluten proteins to form disulfide bonds, and polymerize protein molecules, thereby achieving the effect of strengthening gluten. Lipoxygenase can also destroy the double bond structure of carotenoids through a coupling reaction to bleach flour. Therefore, lipoxygenase has both gluten-strengthening and whitening effects of flour, which can reduce or replace the use of chemical gluten-strengthening agent potassium bromate and chemical bleaching agent ben...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/02C12N15/75C12N15/66C12R1/125
Inventor陆兆新张充吕凤霞章栋梁别小妹王昱沣赵海珍
OwnerNANJING AGRICULTURAL UNIVERSITY