Method for high-flux screening chemical excitons for inducing insect resistance of plants

A screening method and chemical excitation technology, which can be used in material excitation analysis, biological testing, material inspection products, etc., can solve the problems of cumbersome methods, low efficiency, and large biological assay workload, and achieve simple screening methods and reduced workload. Effect

Active Publication Date: 2012-07-11
ZHEJIANG UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current screening of small molecular compounds that induce plant insect resistance, that is, chemical elicitors, is cumbersome, requires a large amount of bioassay work, and is inefficient.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for high-flux screening chemical excitons for inducing insect resistance of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0013] Example 1: The rice volatile linalool can attract the important natural enemy of the brown planthopper, the rice linalool synthase gene OSLIS As an example, the operation steps of the present invention are introduced.

[0014] 1. Linalool synthase gene OSLIS Cloning of promoter sequence and construction of pCAMBIA-LISp vector

[0015] Primers were designed according to the 1500 bp upstream of the transcription start site of the OsLIS gene sequence (GenBank database accession number is AK110925):

[0016] The forward primer is OsLISP-F:CG AAGCTT CGTGTTCATGTACCCCTTTT, reverse primer is OsLISP-R:AG GTC GAC GTGGCAAACCATAGATAAGC, for the convenience of cloning in the next step, HindⅢ and SalⅠ restriction sites were respectively designed at the underline. PCR amplification was carried out using rice genomic DNA as a template, and the amplified product was named LISp. The LISp and pCAMBIA1391 plasmids were double-digested with HindⅢ and SalⅠ, respectively, the digeste...

Embodiment 2

[0022] Embodiment 2: Jasmonic acid is used as the verification experiment of chemical elicitor

[0023] Jasmonic acid (jasmonic acid, JA) is a known bioactive small molecule that can activate rice-induced insect resistance, not only can induce rice to produce direct resistance to stem borer (Zhou G, et al. (2009) Silencing OsHI-LOX makes rice more susceptible to chewing herbs, but enhances resistance to a phloem feeder. Plant J 6 0: 638–648.), and can induce indirect resistance in rice (Lou Y, Du MH, Turlings TCJ, Cheng J, Shan WF (2005a) Exogenous application of jasmonic acid induces volatile emissions in rice and enhances parasitism of Nilaparvata lugens eggs by the parasitoid Anagrus nilaparvatae. Journal of Chemical Ecology, 31: 1985-2002). In this example, JA was dissolved in 50 mM phosphate buffer solution to a final concentration of 5 mg / L when spraying the shoots of JA, and 0.01% Tween-20 was added, and the transgenic rice lines L15-15 and L15-38 Spray 2 ml of ...

Embodiment 3

[0024] Example 3: Screening chemical elicitors from unknown active small molecule compounds

[0025] Dissolve 11 different small molecule compounds A, B, C, D, E, F, G, H, I, J, K with unknown biological activity in 50 mM phosphate buffer to a final concentration of 5 mg / L, and add 0.01 % Tween-20, spray the aerial part of rice line L15-38 in the same way as in Example 1, and use the phosphate buffer solution of spraying 0.01% Tween-20 as a contrast. After 48 h of treatment, the activity of GUS protein in the leaves was measured. At the same time, the wild-type rice was treated in the same way, and after 48 hours of treatment, the behavioral response of the wasp to small molecule-treated wild-type rice plants and buffer-treated wild-type rice plants was measured. The "Y" type olfactometer was used to measure the behavioral response of 50 jasmonic wasps to rice volatiles. The specific operation steps refer to: Lou Y, Du MH, Turlings TCJ, Cheng J, Shan WF (2005a) Exogenous appl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for high-flux screening chemical excitons for inducing insect resistance of plants. The method includes the steps that a paddy rice strain built by transgenosis is processed through different small molecular compounds, and whether the small molecular compounds are active can be judged as per the activity variation of GUS protein or GFP fluorescence protein in a transgenic strain, and the transgenic strain is obtained through connecting promoters of related inducing insect-resistance genes with the GUS protein or the GFP fluorescence protein to built an expression vector for the promoters, and then adopting the infection method of agrobacterium tumefaciens for transgenosis. The method provided by the invention can greatly reduce the workload and the screening cost, greatly improve the screening efficiency of the chemical excitons for inducing insect resistance of the plants, and is particularly suitable for screening on a large scale.

Description

technical field [0001] The invention relates to a screening method for inducing plant insect resistance chemical elicitors, in particular to a high-throughput screening method. Background technique [0002] Induced resistance of plants is an important aspect of plant defense against pests and diseases. Because of its broad-spectrum and long-lasting resistance to diseases and insect pests, it has been increasingly valued by scientists from all over the world. As a function of the plant immune system, inducing resistance has the characteristics of non-specialization, systemicity, persistence and pollution-free. Its application can achieve multiple goals such as multi-resistance, high resistance and pollution-free. It is an important way to control modern plant diseases and insect pests by shifting the control strategies of diseases and insect pests to the internal system of interaction and developing the intrinsic resistance mechanism of plants to prevent and control disease...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): G01N33/68G01N21/63
Inventor娄永根辛肇军宇兆男
OwnerZHEJIANG UNIV