Rice blast resistance gene Piym2 and application thereof
A technology of resistance gene and rice blast, applied in the field of genetic engineering, can solve the problems of weak resistance and easy loss of resistance, and achieve the effects of enhancing resistance, broadening resistance, and improving the efficiency of variety breeding.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Embodiment 1: rice blast resistance gene Piym2 Genetic analysis and preliminary localization of
[0040] In order to discover and identify new blast resistance genes, the susceptible japonica rice variety Lijiangxintuanheigu (LTH for short) and the local japonica rice variety Yangmaogu (YMG for short) that do not carry any main blast resistance gene were tested. ) to prepare a hybrid combination, using F 1 , F 2 and F 3 The group conducted in-depth research on the rice blast resistance genetics of YMG, identified and mapped Piym1 and Piym2 Two major resistance genes. in, Piym2 Resistance to the rice blast strain CH43 from the indica rice region of my country was located on the long arm of the rice chromosome 1 ( figure 1 ).
Embodiment 2
[0041] Embodiment 2: rice blast resistance gene Piym2 fine mapping and candidate gene prediction
[0042] The present invention utilizes map position cloning and bioinformatics method to clone resistance gene Piym2 . To fine-map this gene, use the F from LTH / YMG F 2 There were 1,990 extremely susceptible individual plants and 1,060 extremely disease-resistant individual plants isolated from the rice blast differential strains, through the use of linkage markers and F 3 Subsequent phenotype verification, will Piym2 Localized between markers CAPS2 and dCAPS5. In the Nipponbare reference sequence, this interval is 78.8 Kb and contains 10 candidate genes, of which 4 genes ( Os01g57270 , Os01g57280 , Os01g57310 and Pish ) are genes of NBS-LRR structure related to disease resistance, all of which are clustered on the clone B1100D10, spanning the interval of 52.0Kb. Sequencing found that the interval in YMG is about 43 Kb, and using FGENESH software (http: / / linux1.softbe...
Embodiment 3
[0043] Embodiment 3: rice blast resistance gene Piym2 Isolation of candidate genes and construction of vectors
[0044] in order to isolate Piym2 , according to the obtained sequence, design specific primers for the candidate gene by primer design software, and isolate the candidate gene by PCR with high-fidelity KOD enzyme (TOYOBO); the PCR amplification product is purified and ligated into pCAMBIA1305.1 and pCUbi1390 vector, and transformed into Escherichia coli Trans10 (TransGen Biotech) for preservation. The positive plasmid of the ligation product verified by enzyme digestion was sent to Beijing Biomed Technology Development Co., Ltd. for sequencing (Biomed).
[0045] 1. PCR amplification
[0046] According to the obtained sequences, the specific primers of the candidate genes were designed by primer design software, wherein the primer sequences were:
[0047] 1305F: CCATGATTACGAATTC TTTCATTAGGTGCACCCCACCCACAAG (SEQ ID NO. 3)
[0048] 1305R: TACCGAGCTCGAATTC TGAA...
PUM
Property | Measurement | Unit |
---|---|---|
Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com