Enteric bacilli using glucose as carbon source to synthetize 2-phenyl ethanol
A technology of Enterobacteriaceae and phenylethanol, applied in the direction of bacteria, microorganism-based methods, microorganisms, etc., can solve the problems of high raw material cost, low tolerance of 2-phenylphenylethanol, lack of synthetic strains, etc., and achieve green and natural products. High economic development value, environment-friendly effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1: strain screening
[0037] 1. Medium:
[0038] Selective screening solid medium: beef extract 1.5-2.5g / l, peptone 6-8g / l, glucose 4-6g / l, sodium chloride 3-5g / l, agar 13-16g / l, 2-phenylethanol 4.5~5.5g / l, pH7.0~7.2.
[0039] Liquid medium for producing 2-phenylethanol: beef extract 1.5-2.5g / l, peptone 6-8g / l, glucose 4-6g / l, sodium chloride 3-5g / l, agar 13-16g / l, pH7. 0~7.2.
[0040] 2. Screening method:
[0041] Dissolve 1g of soil sample in 10ml of water, place the water sample at room temperature for 24 hours to activate, then use a sterile pipette to draw 1ml from this test tube and add it to another test tube filled with 9ml of sterile water, mix well, and so on. 10 -1 、10 -2 、10 -3 、10 -4 、10 -5 、10 -6 Soils of different dilutions.
[0042] Take different concentrations of diluted soil bacteria liquid and spread it on a plate containing 2-phenylethanol, and pick a single colony after 72 hours of culture for liquid culture. After 12-24 hours of ...
Embodiment 2
[0043] Example 2: Identification of bacterial strain 16S rDNA
[0044] 1. Culture medium and materials
[0045] LB medium: peptone 9-11g / l, yeast powder 4.5-5.5g / l, yeast powder 9-11g / l, sodium chloride 1-4g / l, pH7.0-7.5, sterilized at 112°C for 30 minutes.
[0046] LA medium: Add 50 μg to 100 μg of ampicillin to LB medium.
[0047] LB / LA solid medium: add 1.5% agar to the above LB / LA medium.
[0048] TAE: 50 times tris-acetate-EDTA (2M tris-acetate, 0.05M EDTA, pH8.3).
[0049] Agarose electrophoresis gel: add 0.8-1.2% agarose gel to 1 times TAE electrophoresis buffer.
[0050] 2.16S rDNA assay
[0051] For the extraction of genomic DNA, the bacteria grown in LB liquid medium (about 12 to 24 hours) were centrifuged. Genomic DNA was extracted, and then detected by electrophoresis with 1% agarose gel electrophoresis. Qualified DNA was tested for PCR gene amplification. The primers used in PCR were fD1: AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 1), rP2: CGGCTACCTTGTTACGACTT (SEQ ID...
Embodiment 3
[0078] Embodiment three: product identification
[0079] Pick a single colony and inoculate it in the above-mentioned (Example 1) 250ml shake flask containing 50ml of 2-phenylethanol-producing liquid medium, and cultivate it at 35~39°C for about 12~24 hours, according to the ratio of fermentation broth volume and n-butanol: 5:1 for extraction. The n-butanol phase was extracted and centrifuged, filtered through a 0.22 μM membrane, detected by GC-Ms, and control and standard samples were set.
[0080] GC-Ms detection method: column model HP-INNOWax Polyethylene Glyco: 1170.71016 column oven temperature 50 ° C for 1 min, then 10 ° C / min to 240 ° C, maintenance time 20 minutes, total running time 40 minutes, detector temperature 260 ° C, vaporization chamber The temperature is 240°C. The gas chromatogram of the identified product 2-phenylethanol is as follows: figure 1 As shown, the mass spectrum is as figure 2 shown.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More