A kind of Antarctic ice alga cpd photorepair enzyme, its coding gene and expression vector and the application of the enzyme

A technology of photorepair enzymes and Antarctic ice algae, applied in the field of biology, can solve problems such as the lack of photorepair enzymes, the separation and purification of biological photorepair enzymes, and the research difficulties in in vitro activity, etc., to achieve anti-aging, great significance, and huge social benefit effect

Inactive Publication Date: 2016-03-30
QINGDAO HENGSHENG BIOLOGICAL PHARMA TECH DEV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The content of photorepair enzymes in organisms is very small, and each cell has about 10 to 20 photorepair enzyme molecules, which makes it extremely difficult to directly conduct research on the separation, purification and in vitro activity of photorepair enzymes in organisms

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of Antarctic ice alga cpd photorepair enzyme, its coding gene and expression vector and the application of the enzyme
  • A kind of Antarctic ice alga cpd photorepair enzyme, its coding gene and expression vector and the application of the enzyme
  • A kind of Antarctic ice alga cpd photorepair enzyme, its coding gene and expression vector and the application of the enzyme

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1. Obtaining the cDNA sequence of the Antarctic ice alga Chlamydomonassp.ICE-LCPD photorepair enzyme

[0042] 1. Cultivation of Antarctic ice algae and isolation of total RNA

[0043] The Antarctic ice algae were cultured to the logarithmic phase at 4°C, and the RNA was extracted with Trizol from Invitrogen Company. The test was carried out according to the extraction process instructions of Trizol reagent. No RNase contamination was ensured throughout the process. The extracted RNA was divided into small portions and stored in a -80°C refrigerator for later use.

[0044] 2. Acquisition of cDNA sequence of CPD photorepair enzyme gene

[0045] Primers were designed according to the ice algae transcriptome sequence obtained earlier:

[0046] 5'-RACE Primer GSP1:CGAGCACATGGGTCGTTCCCTCTTATCG

[0047] 3'-RACE Primer GSP2:TGGGACGGAAGTGGAGGGATGAGGT

[0048] The obtained high-quality RNA was reverse-transcribed to synthesize cDNA.

[0049] The 5'-RACE reverse trans...

Embodiment 2

[0057] Example 2. Construction of Antarctic ice algae Chlamydomonassp.ICE-LCPD photorepair enzyme expression vector

[0058] 1. Design primers according to the complete sequence of the photorepair enzyme gene obtained by sequencing:

[0059] CPDF:TAGAATTCATGCCGAAGCGAAC

[0060] CPDR: TATCTCGAGTCAAGCTCGTGGC

[0061] The PCR reaction conditions were: pre-denaturation at 95°C for 10 minutes, denaturation at 95°C for 15 seconds, annealing at 55°C for 1 minute, and extension at 72°C for 2 minutes for 30 cycles.

[0062] 2. The PCR amplification product of the photorepair enzyme gene and the prokaryotic expression vector pET-28a(+) were respectively digested with EcoRI and XhoI at 37°C for 2 hours, recovered with 1.0% agarose, and the purified target fragment And the vector was ligated with T4 DNA ligase at 16°C for 16h, and the ligation system was as follows.

[0063]

[0064] 3. Transform the ligated recombinant plasmid into Escherichia coli DH5α, the steps are as follows: ...

Embodiment 3

[0072] Example 3. Purification and protein detection of Antarctic ice alga Chlamydomonassp.ICE-LCPD photorepair enzyme

[0073] 1. Inoculate the recombinant bacterium BL21(DE3) / pET-28a(+) / phr in 5 mL of LB liquid medium containing kanamycin, and cultivate overnight at 37°C with shaking. On the next day, take 5 mL of the bacterial liquid and insert it into 500 mL of the same medium to continue culturing for 2 to 3 hours (OD600 about 0.6), then add IPTG at a final concentration of 1 mM, shake and culture at 10°C for 24 hours, centrifuge at 8000 g for 10 minutes, and collect the bacteria.

[0074] 2. Ni agarose affinity column affinity chromatography: put the metal chelating agent Ni agarose into the chromatographic column, and equilibrate with 1×Ni column binding buffer. Apply the supernatant to the column. Generally, 40mM imidazole is used to elute to obtain the target protein.

[0075] 3. Take the above induced BL21(DE3) / pET-28a(+) / phr cells and the purified protein expresse...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

Disclosed is an Antarctic ice algae CPD photolyase, a protein as set out in (a) or (b): (a) an amino acid sequence represented by SEQ ID NO:2; (b) a protein derivative of (a) having CPD photolyase activity, the amino acid sequence of which having been subjected to substitution, deletion or addition of 1 to 10 amino acid residues. Also disclosed are an Antarctic ice algae CPD photolyase coding gene and expression vector, and application of the Antarctic ice algae CPD photolyase in fields relating to cosmetics and biopharmaceuticals. The present invention clones the Antarctic ice algae CPD photolyase gene for the first time, successfully cloning said gene into the expression vector, and thereby obtaining a large quantity of CPD photolyase. The CPD photolyase has applications within fields relating to cosmetics and biopharmaceuticals, and may actively repair disorders caused by ultraviolet rays, thus being of great significance and benefit to society.

Description

technical field [0001] The invention relates to the technical field of biology, in particular to CPD photorepair enzyme in Antarctic ice algae Chlamydomonassp.ICE-L, its encoding gene, and application of Antarctic ice algae CPD photorepair enzyme. Background technique [0002] With the rapid development of modern industrial production, the ozone layer in the atmosphere has been destroyed, and the appearance and expansion of the ozone hole at the north and south poles has increased the ultraviolet rays in the sunlight radiated to the earth's surface, causing the biosphere to be increasingly damaged by ultraviolet rays. Large doses of ultraviolet rays (mainly UV-B) are a catastrophic threat to the entire ecological environment of the earth. Ultraviolet light has significantly inhibited photosynthesis of phytoplankton communities in Antarctic waters. The root cause of its harm is that the four bases of DNA in organisms have strong absorption in the near ultraviolet band (UV-B,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/88C12N15/60C12N15/63A61K8/66A61K38/51A61P17/16A61Q17/04
CPCA61K8/66A61K8/9722A61K38/00A61P17/16A61Q19/004C12N9/88C12Y401/99003
Inventor缪锦来许建方马莉
OwnerQINGDAO HENGSHENG BIOLOGICAL PHARMA TECH DEV