Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Bacillus subtilis Pc3 and use of bacillus subtilis Pc3 in preparation of fermentation supernatant for preventing and controlling plant pathogenic fungi

A Bacillus subtilis, fermentation supernatant technology, applied in the application, plant growth regulators, botanical equipment and methods, etc., can solve the problems of difficult new agricultural active substances, high screening technology requirements, and long research and development time. , to achieve the effects of good biocontrol effect, broad antifungal spectrum and simple preparation process

Active Publication Date: 2014-02-19
THIRD INST OF OCEANOGRAPHY STATE OCEANIC ADMINISTATION
View PDF1 Cites 28 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the long research and development time and high requirements for screening technology, it is becoming more and more difficult to screen and obtain new agricultural active substances

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus subtilis Pc3 and use of bacillus subtilis Pc3 in preparation of fermentation supernatant for preventing and controlling plant pathogenic fungi
  • Bacillus subtilis Pc3 and use of bacillus subtilis Pc3 in preparation of fermentation supernatant for preventing and controlling plant pathogenic fungi
  • Bacillus subtilis Pc3 and use of bacillus subtilis Pc3 in preparation of fermentation supernatant for preventing and controlling plant pathogenic fungi

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1: Isolation and screening of Bacillus subtilis Pc3

[0020] The present invention relates to Bacillus subtilis (Bacillus subtilis) Pc3 which is obtained from the seawater sample collected by the applicant from China's 28th Antarctic scientific expedition. The body is light yellow, the colony is larger, and the colony is drop-shaped in the early stage of growth, see figure 1 .

Embodiment 2

[0021] Embodiment 2: Bacillus subtilis (Bacillus subtilis) Pc3 strain identification

[0022] The 16S rDNA universal primers 27F and 1495R (27F: AGAGTTTGATCCTGGCTCAT; 1495R: ACGGCTACCTTGTTACGACTT) were used to amplify the Antarctic-derived strain Pc316S rDNA sequence. The total DNA of Bacillus subtilis (Bacillus subtilis) Pc3 was used as the template for PCR amplification, and the PCR reaction was carried out on an Eppendorf PCR amplifier. The reaction conditions were: denaturation at 94°C for 1 min; annealing at 55°C for 1 min; extension at 72°C for 1.5 min, 30 cycles. The amplified gene was sent to a sequencing company for sequencing. After obtaining the 16S rDNA sequence of the strain, the sequence was compared with the nucleic acid data in GeneBank by NCBI BLAST ( http: / / ncbi.nlm.nih.gov / blast ). It was found that the sequence similarity between Pc316S rDNA sequence and Bacillus subtilis (EU257448.1), Bacillus amyloliquefaciens (KF181458.1), Bacillus amyloliquefaciens (...

Embodiment 3

[0023] Embodiment 3: the mensuration of phytopathogenic fungi antimicrobial spectrum

[0024] The inhibitory activity of Bacillus subtilis (Bacillus subtilis) Pc3 against seven plant pathogenic fungi was determined by the filter paper method. Use a sterile puncher with a diameter of 6 mm to make the test pathogenic fungus into a bacterial block, pick a bacterial block with a toothpick and place it in the center of the potato solid medium (PDA) plate, and cultivate it at 28°C for 1 to 2 days, wait for After the mycelium of the pathogenic fungus to be tested spreads and grows, place a number of sterilized double-layer filter paper sheets with a diameter of 6 mm around each bacterial block, the filter paper sheets are 0.5-1 cm away from the center of the bacterial block, and then add 50 μL of The aseptic fermentation supernatant of the tested fungus was cultured for 2 to 3 days, and compared with the control culture, it was observed whether the growth of the mycelium would be inh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to bacillus subtilis Pc3 and a use of bacillus subtilis Pc3 in preparation of a fermentation supernatant for preventing and controlling plant pathogenic fungi, and relates to bacilli. The bacillus subtilis Pc3 has a preservation number of CCTCC NO: M2013470. The bacillus subtilis Pc3 can prevent and control plant pathogenic fungi such as gloeosporium musarum, paecilomyces variotii, sclerotinia sclerotiorum, alternaria longipes, trichoderma viride, rhizoctonia solani and fusaria. A rape sclerotinia sclerotiorum prevention and control pot experiment proves that the bacillus subtilis Pc3 has good biological-prevention and control effects and has prevention and control efficiency of 95.6%. The fermentation supernatant of the bacillus subtilis Pc3 can be prepared by simple processes and has a wide fungus inhibition spectrum and good biological prevention effects.

Description

technical field [0001] The invention relates to a bacillus, in particular to a bacillus subtilis Pc3 and its application in preparing a fermentation supernatant for preventing and controlling plant pathogenic fungi. Background technique [0002] With the resistance of plant diseases and insect pests to existing pesticides and the emergence of new diseases, it is required to continuously develop new pesticides. Microbial resources have always been the focus of research by agricultural workers, and finding new microbial-derived lead compounds or active products is one of the main means of pesticide creation. However, due to the long research and development time and high requirements for screening technology, it is becoming more and more difficult to screen and obtain new agricultural active substances. From the perspective of the process of new drug development, most of them still come from natural resources (Bevan et al.1995), including activity screening of microorganisms ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A01N63/00A01P3/00C12R1/125
Inventor 陈新华郭文斌崔鹏飞
Owner THIRD INST OF OCEANOGRAPHY STATE OCEANIC ADMINISTATION
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com