Oligonucleotide and method for joint detection of relative transcript levels of genes PTEN (phosphatase and tensin homolog deleted on chromosome ten) and VEGF (vascular endothelial cell growth factor)
A technology of relative expression level and PTEN-F, which is applied in the field of life science and biology, can solve problems such as false positives and PCR product contamination, and achieve simple operation, good specificity, and good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0066] Example 1 Oligonucleotides and kits for combined detection of PTEN and VEGF
[0067] Oligonucleotides used to jointly detect the relative expression levels of genes PTEN and VEGF in a sample, the oligonucleotides include:
[0068] (1) Detection gene PTEN upstream primer PTEN-F, downstream primer PTEN-R and probe PTEN-Probe, its base sequence is:
[0069] PTEN-F:CAAAAAGGGAGTAACTATTCC
[0070] PTEN-R: GTGAAACAACAGTGCCACTG
[0071] PTEN-Probe:FAM-CCTGTTAAAGAATCATCTGGATTA-TAMRA
[0072] (2) Detection gene VEGF upstream primer VEGF-F, downstream primer VEGF-R and probe VEGF-Probe, the base sequence is:
[0073] VEGF-F: CCTTGCCTTGCTGCTCTAC
[0074] VEGF-R: ACCACTTCGTGATGATTCTGCC
[0075] VEGF-Probe: FAM-TGGTCCCAGGCTGCACCCA-TAMRA
[0076] (3) Detect the upstream primer Actin-F, downstream primer Actin-R and the probe Actin-Probe of the internal reference gene actin. The base sequence is:
[0077] Actin-F:TGAGCGAGGCTACAGCTT
[0078] Actin-R:TCCTTGATGTCGCGCACGATTT
[0079] Actin-Probe: FAM-ACCACC...
Embodiment 2
[0098] Example 2 Detection Process
[0099] (1) Extract tissue RNA from paraffin sections: cut off the tissue or paraffin section samples in a 1.5ml centrifuge tube (scrape); add 1ml tissue clear solution, shake and mix, and centrifuge at 13000rpm for 1min; remove the supernatant and add 500ml Tissue clear liquid, shake and mix, and centrifuge at 13000rpm for 1min; remove the supernatant, add 1ml of absolute ethanol, shake and mix, and centrifuge at 13000rpm for 1min; after removing the supernatant, put it in a 37℃ metal bath for 10min (open the lid) until the liquid is dry; RNeasy FFPEKit paraffin RNA extraction kit instructions, extract sample RNA.
[0100] (2) Refer to the instruction of the Rever Tra Ace qPCR RT Kit from TOYOBO, and reverse the RNA to cDNA. (3) Reagent configuration: Xμl each PCR reaction solution of the detection system is configured according to the number of test persons, 25μl each is divided into:
[0101] X=25μl reaction solution×(8 internal reference gene...
Embodiment 3
[0117] Example 3 Detection of clinical samples
[0118] Take 20 paraffin section samples of cancer tissues submitted for examination, extract tissue RNA according to the method described in Example 2, reverse transcribe the tissue RNA into cDNA, respectively prepare detection reagents for genes PTEN, VEGF and internal reference gene actin, and test them.
[0119] For each sample, 2ul of the obtained cDNA was added to the PCR reaction solution of the gene PTEN detection system, the PCR reaction solution of the gene VEGF detection system and the PCR reaction solution of the internal reference gene actin detection system. At the same time, do the positive control, negative control and blank control experiment once each. A 96-well fluorescent PCR machine can detect 20 samples at the same time, each sample is repeated twice, one positive control experiment, one negative control experiment and one blank control experiment. The detection time is only 100 minutes. The experimental result...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com