Unlock instant, AI-driven research and patent intelligence for your innovation.

Oligonucleotide and method for joint detection of relative transcript levels of genes PTEN (phosphatase and tensin homolog deleted on chromosome ten) and VEGF (vascular endothelial cell growth factor)

A technology of relative expression level and PTEN-F, which is applied in the field of life science and biology, can solve problems such as false positives and PCR product contamination, and achieve simple operation, good specificity, and good specificity

Inactive Publication Date: 2014-04-23
合肥艾迪康医学检验实验室有限公司
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] In order to solve the deficiency of SYBR Green I dye method and double-probe hybridization method in the real-time fluorescent quantitative PCR technique, the present invention adopts the real-time fluorescent quantitative PCR method in conjunction with Taqman probe method, and it integrates biology, enzymology and fluorescent chemistry into one, From amplification to result analysis, the PCR reaction tube is closed, which solves the problem of false positives caused by PCR product contamination, and also improves the sensitivity. The result is expressed in copy number, realizing accurate quantification of PCR products , easy to unify standards, compared with qualitative PCR technology, it has the advantages of good specificity, high sensitivity, simple operation, high degree of automation, anti-pollution and large linear range, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oligonucleotide and method for joint detection of relative transcript levels of genes PTEN (phosphatase and tensin homolog deleted on chromosome ten) and VEGF (vascular endothelial cell growth factor)
  • Oligonucleotide and method for joint detection of relative transcript levels of genes PTEN (phosphatase and tensin homolog deleted on chromosome ten) and VEGF (vascular endothelial cell growth factor)
  • Oligonucleotide and method for joint detection of relative transcript levels of genes PTEN (phosphatase and tensin homolog deleted on chromosome ten) and VEGF (vascular endothelial cell growth factor)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Example 1 Oligonucleotides and kits for combined detection of PTEN and VEGF

[0067] Oligonucleotides used to jointly detect the relative expression levels of genes PTEN and VEGF in a sample, the oligonucleotides include:

[0068] (1) Detection gene PTEN upstream primer PTEN-F, downstream primer PTEN-R and probe PTEN-Probe, its base sequence is:

[0069] PTEN-F:CAAAAAGGGAGTAACTATTCC

[0070] PTEN-R: GTGAAACAACAGTGCCACTG

[0071] PTEN-Probe:FAM-CCTGTTAAAGAATCATCTGGATTA-TAMRA

[0072] (2) Detection gene VEGF upstream primer VEGF-F, downstream primer VEGF-R and probe VEGF-Probe, the base sequence is:

[0073] VEGF-F: CCTTGCCTTGCTGCTCTAC

[0074] VEGF-R: ACCACTTCGTGATGATTCTGCC

[0075] VEGF-Probe: FAM-TGGTCCCAGGCTGCACCCA-TAMRA

[0076] (3) Detect the upstream primer Actin-F, downstream primer Actin-R and the probe Actin-Probe of the internal reference gene actin. The base sequence is:

[0077] Actin-F:TGAGCGAGGCTACAGCTT

[0078] Actin-R:TCCTTGATGTCGCGCACGATTT

[0079] Actin-Probe: FAM-ACCACC...

Embodiment 2

[0098] Example 2 Detection Process

[0099] (1) Extract tissue RNA from paraffin sections: cut off the tissue or paraffin section samples in a 1.5ml centrifuge tube (scrape); add 1ml tissue clear solution, shake and mix, and centrifuge at 13000rpm for 1min; remove the supernatant and add 500ml Tissue clear liquid, shake and mix, and centrifuge at 13000rpm for 1min; remove the supernatant, add 1ml of absolute ethanol, shake and mix, and centrifuge at 13000rpm for 1min; after removing the supernatant, put it in a 37℃ metal bath for 10min (open the lid) until the liquid is dry; RNeasy FFPEKit paraffin RNA extraction kit instructions, extract sample RNA.

[0100] (2) Refer to the instruction of the Rever Tra Ace qPCR RT Kit from TOYOBO, and reverse the RNA to cDNA. (3) Reagent configuration: Xμl each PCR reaction solution of the detection system is configured according to the number of test persons, 25μl each is divided into:

[0101] X=25μl reaction solution×(8 internal reference gene...

Embodiment 3

[0117] Example 3 Detection of clinical samples

[0118] Take 20 paraffin section samples of cancer tissues submitted for examination, extract tissue RNA according to the method described in Example 2, reverse transcribe the tissue RNA into cDNA, respectively prepare detection reagents for genes PTEN, VEGF and internal reference gene actin, and test them.

[0119] For each sample, 2ul of the obtained cDNA was added to the PCR reaction solution of the gene PTEN detection system, the PCR reaction solution of the gene VEGF detection system and the PCR reaction solution of the internal reference gene actin detection system. At the same time, do the positive control, negative control and blank control experiment once each. A 96-well fluorescent PCR machine can detect 20 samples at the same time, each sample is repeated twice, one positive control experiment, one negative control experiment and one blank control experiment. The detection time is only 100 minutes. The experimental result...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides oligonucleotide and a method for joint detection of relative transcript levels of genes PTEN (phosphatase and tensin homolog deleted on chromosome ten) and VEGF (vascular endothelial cell growth factor) based on fluorogenic quantitative PCR (Polymerase Chain Reaction), mainly relating to a forward primer PTEN-F, a reverse primer PTEN-R and a probe PTEN-Probe for detecting the gene PTEN; an forward primer VEGF-F, a reverse primer VEGF-R and a probe VEGF-Probe for detecting the gene VEGF; and a forward primer Actin-F, a reverse primer Actin-R and a probe Actin-Probe for detecting a reference gene actin. The relative transcript levels of the detected genes PTEN and VEGF are respectively compared with reference values of the relative transcript levels of the genes PTEN and VEGF of a healthy person, and the comparison result can be used for auxiliary diagnosis of various kinds of cancers.

Description

Technical field [0001] The present invention belongs to the field of life science and biotechnology, and relates to oligonucleotides and methods for jointly detecting the relative expression levels of genes PTEN and VEGF. Using probe real-time fluorescent quantitative PCR technology, it can compare PTEN and VEGF in various human cancer tissues. Detection of expression level can effectively save detection time and improve detection accuracy. Background technique [0002] The phosphatase and tensin homology deleted on chromosome ten (PTEN) gene, located on chromosome 10, is a new tumor suppressor gene discovered in 1997 and the first to date to have a phosphatase Active tumor suppressor gene (LI J, YEN C, LIAW DU, et al. PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast and prostate cancer. Science, 1997, 275(5308): 1943-1947). According to Wu Yuanqing reported that the PTEN gene is located on chromosome 10q23, and its expression product PTEN protei...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6886C12Q2600/106C12Q2600/158
Inventor 周晓犊薛群王淑一
Owner 合肥艾迪康医学检验实验室有限公司