Reconstruction method of cellulosome gene and obtained cellulase

A cellulase and cellulosome technology, applied in the field of genetic engineering and enzyme engineering, can solve the problems of low cell density, waste of biological energy, harsh culture conditions, etc., achieve high activity, high activity and stability, and facilitate genetic engineering. production effect

Inactive Publication Date: 2016-09-14
JIANGSU UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Today, with the high development of molecular biotechnology, we have found that the production of cellulosomes has its fatal weakness: (1) The cellulosome-producing bacteria are thermophilic anaerobic bacteria with harsh culture conditions, low cell density, and low enzyme production efficiency. Very low; (2) Cellulosomes are encoded by multiple genes with a total molecular mass of more than 2000 kDa, making it difficult to recombine and express in vitro; (3) Cellosomes contain nearly 20 different monomeric enzymes, many of which are not It is necessary for the hydrolysis of cellulose, and the activity of some monomeric enzymes is not as good as that of similar enzymes from other sources. Therefore, the production of these monomeric enzymes is a waste of biological energy; (4) The activity of various monomeric enzymes in cellulosomes depends on CBD on the scaffold, the catalytic activity of the monomeric enzyme decreased after leaving the scaffold

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reconstruction method of cellulosome gene and obtained cellulase
  • Reconstruction method of cellulosome gene and obtained cellulase
  • Reconstruction method of cellulosome gene and obtained cellulase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Target gene amplification from Clostridium thermocellum genomic DNA

[0034] Primer design: According to the gene sequence of Clostridium thermocellum (ATCC 27405) cellulase (CelD) reported in NCBI, see SEQ ID NO.1, the signal peptide sequence of the gene was removed, and two primer sequences (5' end containing Pst I and Xho I restriction sites respectively):

[0035] celD-1: 5' AAAACTGCAGGCAAAAATAACGGAGAATTATC 3'

[0036] celD-2: 5' CCGCTCGAGTTATATTGGTAATTTCTCGATTAC 3'

[0037] Genome PCR amplification conditions: Cultivate Clostridium thermocellum cells, extract genomic DNA as a template. Add 2 μL (20 ng) template, 2 μL 10 μM primer, 4 μL 2.5 μM dNTP, 10 μL 5×Prime STAR HS DNA polymerase buffer, 31.5 μL ultrapure water and 50 μL PCR reaction system. 0.5 μL of Prime STAR HS DNA Polymerase. According to the temperature cycle (denaturation at 98°C for 10 s, annealing at 60°C for 15 s, extension at 72°C for 2.5 min), amplify for 30 cycles, and extend at 72°...

Embodiment 2

[0038] Embodiment 2: Construction of the expression plasmid of monomeric enzyme gene in Clostridium thermocellum cellulosome

[0039] The above PCR product was recovered by tapping rubber, subjected to Pst I and Xho I double enzyme digestion, and cloned into the prokaryotic expression vector pHsh plasmid. Transform into E. coli DH10B, and culture transformants in LB medium containing ampicillin (100 μg / mL). Plasmids were extracted from transformants, digested with Pst I, and the inserted gene was verified and sequenced. The results showed that the length of the inserted gene was 1827bp, the code contained 609 amino acid residues, and the sequence was consistent with the celD sequence in the database. The expression plasmid was named pHsh-CelD.

Embodiment 3

[0040] Example 3: Molecular reconstruction of gene celD

[0041] Primer design: According to the anchor domain information in the peptide chain of the CelD protein in the NCBI website database, two reverse PCR primers were designed and synthesized, using pHsh-CelD as a template, and PCR amplified to obtain the anchor domain coding sequence celD- The plasmid fragment of d (SEQ ID NO.2) forms a new plasmid pHsh-celD-d after concatenation; according to the NCBI data, the cbd gene cbd (SEQ ID NO.3 ), at the same time, design primers to link celD-d and cbd together to obtain the gene sequence celD-d+cbd (SEQ ID NO.4), and finally design and synthesize a pair of PCR primers to amplify Lcbd with a linking fragment ( SEQ ID NO.5), the new enzyme gene celD-d+Lcbd is formed after linking celD-d and Lcbd, which we renamed ncelD (SEQ ID NO.6).

[0042] dockerin-up: TAACTCGAGCACCACCACC

[0043] dockerin-dn: TTGAGGAGAATTATAGTTGACA

[0044] cbd-1: AACGTTGGCAATGCAACACC

[0045] cbd-2: GCT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a reconstruction method for a cellulosome gene and a new enzyme obtained through gene reconstruction, in particular relates to a gene reconstruction method based on a cellulosome and a monomeric enzyme of clostridium thermocellum and a novel lignocellulose hydrolase produced through gene reconstruction, and belongs to the field of gene engineering and enzyme engineering. A dockerin in a monomeric enzyme peptide chain of the cellulosome is excided through a gene reconstruction technology to reduce redundant components, and a CBD on a scaffolding protein is grafted to a molecule of the monomeric enzyme by a short chain to obtain a novel independent enzyme which has different molecular structures, can be independently bound with a substrate and has high activity compared with the monomeric enzyme; the invention further establishes an over-expression technology of the new enzyme. The novel cellulase NcelD without depending on a cellulosome structure is successfully obtained; the CMC hydrolysis activity and stability of the novel cellulase NcelD are improved obviously compared with a natural monomeric enzyme CelD; the NcelD coding gene obtained through gene reconstruction is subjected to soluble over-expression in a pHsh system.

Description

technical field [0001] The invention relates to a cellulosome gene modification method and a new enzyme obtained through gene modification, in particular to a gene modification method based on the cellulosome of Clostridium thermocellum and its monomeric enzyme, and the gene modification method The produced novel lignocellulosic hydrolyzing enzyme belongs to the fields of genetic engineering and enzyme engineering. Background technique [0002] Wood fiber is the supporting tissue of plants on the earth, and its main component is carbohydrates through photosynthesis, which is a very rich natural resource. At the same time, many microorganisms and herbivorous animals in nature can produce a series of enzymes to hydrolyze lignocellulose, which constitutes an important part of the carbon cycle in nature. The main enzymes that hydrolyze the cellulose component in lignocellulosics include cellulase, exocellulase, cellobiase and b-glucosidase, etc. Cellulase is short for b-1,4 en...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/56C12N15/10C12N9/42C12N15/70C12R1/145
Inventor邵蔚蓝王洪成王蒙
OwnerJIANGSU UNIV