Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of recombinant porcine defensin and its preparation method and application

A technology of recombinant bacteria and recombinant vectors, applied in the field of genetic engineering, can solve the problems of unexpressed recombinant porcine defensins, high cost of chemically synthesized defensins, and low expression of natural defensins, achieving good industrial application prospects and antibacterial activity High, low-cost effect

Active Publication Date: 2016-09-07
四川华德生物工程有限公司
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Porcine defensin is a member of the antimicrobial peptide family and has good antibacterial activity. However, the expression of natural defensin in pigs is low, the molecule is small, it is difficult to separate, and the cost of chemical synthesis of defensin is high. Therefore, molecular biology techniques are used to recombine and express foreign genes It is an effective way to obtain the target protein
[0004] Peng Zhanghua et al., "Clone of porcine defensin PBD-1 gene and construction of its expression vector", Genetics and Breeding, China Animal Husbandry and Veterinary Medicine, Volume 32, No. 11, 2005 and Luo Gang et al., "Porcine defensin gene PBD-I in the Recombination and Fusion Expression in Bacteria", Genetics, Volume 2, No. 25, 2003, all disclosed methods for constructing recombinant expression vectors of porcine defensin gene PBD-1, but no active recombinant porcine defensin was expressed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of recombinant porcine defensin and its preparation method and application
  • A kind of recombinant porcine defensin and its preparation method and application
  • A kind of recombinant porcine defensin and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0070] 4.2 Preparation of standard solution

[0071] 4.2.1 Colistin sulfate standard solution

[0072] Accurately weigh 0.0360g of colistin sulfate standard (China Veterinary Drug Administration, content 22156U / mg), dilute to 10mL with reagent 3.5 phosphate buffer, 2000rpm, centrifuge for 10min and then dilute 10 times as high dose concentration, And it was diluted 1 times to make two concentration gradient solutions of high and low doses.

[0073] 4.2.2 Substances to be tested for test

[0074] Accurately weigh 3.8000g of the substance to be tested, dissolve it in 6.2mL of phosphate buffer, mix well, centrifuge at 2000rpm for 10min, leave the supernatant as the high-dose concentration, and dilute it by 1 times to make it into high and low doses Two concentration gradient solutions.

[0075] 4.3 Preparation of plates

[0076] Use a sterile 20mL pipette to transfer 15mL of the plate reagent 3.1 bottom agar onto the plate, and place the plate on a horizontal operating table ...

Embodiment 1

[0095] Example 1 Preparation of engineered bacteria containing target gene fragments

[0096] 1. Acquisition of recombinant defensin polypeptide gene

[0097] 1. Obtain and express recombinant defensin polypeptide gene with antibacterial activity

[0098] The known porcine defensin sequences PBD1, PBD2 and PBD were retrieved from the NCBI database, and multiple sequence alignment and analysis were performed on them. The adjusted DNA sequences were synthesized to obtain a new gene sequence Consensus:

[0099] CCTACA CTGCGA AAAAAGGGGCA GTGTA T TT

[0100] GCATGCCCTCCAAAGAAGAAACAGATAGGTACCTGTTTTGCCAAG

[0101] CAAGTGCTGCA AAGG;

[0102] The synthetic defensin gene (Consensus) was amplified by high-fidelity PCR method, the amplified DNA was partially degraded by DNase I, the degraded DNA was repeatedly denatured and renatured, and then amplified by high-fidelity primerless PCR method; The designed gene primers (5' primer sequence: atgc(a / g / c)ctaca(g / a / t)ctgc, 3' primer sequenc...

Embodiment 2

[0118] Example 2 Expression and purification of recombinant porcine defensin of the present invention

[0119] 1. Expression method

[0120] (1) Expression

[0121] Take the engineering bacteria (positive transformants) obtained in Example 1, put them in 5 ml of BMGY medium, culture them on a shaker at 30°C for 48 hours, and collect the cells by centrifugation; then use the BMMY induction medium to suspend the cells, and induce the cells at 30°C. After culturing for 120h, samples were taken at 12h intervals to detect the antibacterial activity.

[0122] The supernatant of the samples induced to culture for 96h was taken, and the antibacterial activity was tested again, and identified by SDS-PAGE.

[0123] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol;

[0124] BMMY induction medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10 -5 % Biotin, 0.5% ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
wavelengthaaaaaaaaaa
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a recombinant porcine defensin with the amino acid sequence represented as SEQ ID NO.1. The invention further discloses an engineering bacterium expressing the recombinant porcine defensin as well as a fermentation method and a fermentation product of the engineering bacterium. The recombinant porcine defensin is high in antibacterial activity and can be used for preparing antibacterial drugs. The fermentation product of the engineering bacterium is high in antibacterial activity, safe, high in nutritive value, capable of being used for preparing antibacterial feed additives, simple in process step, low in cost and broad in industrial application prospect.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a recombinant porcine defensin and a preparation method and application thereof. Background technique [0002] Antibacterial Peptides (ABPs), also known as Antimicrobial Peptides (AMPs), in a broad sense, refers to a class of small molecular peptides that widely exist in the body to resist external microbial invasion and clear mutant cells in the body. An important part of the defense system, which plays an important role in the mucosal immune system, is called "the first defense system" or "the first immune system". Antibacterial peptides are widely found in bacteria, plants, invertebrates and vertebrates. They not only have broad-spectrum antibacterial ability, but also have a certain inhibitory effect on fungi, viruses and cancer cells. In addition, it also has the characteristics of stability, good water solubility, unique antibacterial mechanism, no drug resistance, and h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/47C12N15/12C12N15/81C12N1/19C12P21/02C07K1/36C07K1/30C07K1/20C07K1/18C07K1/16A61K38/17A61P31/04A23K20/195C12R1/84
CPCC07K14/4723
Inventor 李钢王小忠王小行
Owner 四川华德生物工程有限公司