A kind of recombinant porcine defensin and its preparation method and application
A technology of recombinant bacteria and recombinant vectors, applied in the field of genetic engineering, can solve the problems of unexpressed recombinant porcine defensins, high cost of chemically synthesized defensins, and low expression of natural defensins, achieving good industrial application prospects and antibacterial activity High, low-cost effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0070] 4.2 Preparation of standard solution
[0071] 4.2.1 Colistin sulfate standard solution
[0072] Accurately weigh 0.0360g of colistin sulfate standard (China Veterinary Drug Administration, content 22156U / mg), dilute to 10mL with reagent 3.5 phosphate buffer, 2000rpm, centrifuge for 10min and then dilute 10 times as high dose concentration, And it was diluted 1 times to make two concentration gradient solutions of high and low doses.
[0073] 4.2.2 Substances to be tested for test
[0074] Accurately weigh 3.8000g of the substance to be tested, dissolve it in 6.2mL of phosphate buffer, mix well, centrifuge at 2000rpm for 10min, leave the supernatant as the high-dose concentration, and dilute it by 1 times to make it into high and low doses Two concentration gradient solutions.
[0075] 4.3 Preparation of plates
[0076] Use a sterile 20mL pipette to transfer 15mL of the plate reagent 3.1 bottom agar onto the plate, and place the plate on a horizontal operating table ...
Embodiment 1
[0095] Example 1 Preparation of engineered bacteria containing target gene fragments
[0096] 1. Acquisition of recombinant defensin polypeptide gene
[0097] 1. Obtain and express recombinant defensin polypeptide gene with antibacterial activity
[0098] The known porcine defensin sequences PBD1, PBD2 and PBD were retrieved from the NCBI database, and multiple sequence alignment and analysis were performed on them. The adjusted DNA sequences were synthesized to obtain a new gene sequence Consensus:
[0099] CCTACA CTGCGA AAAAAGGGGCA GTGTA T TT
[0100] GCATGCCCTCCAAAGAAGAAACAGATAGGTACCTGTTTTGCCAAG
[0101] CAAGTGCTGCA AAGG;
[0102] The synthetic defensin gene (Consensus) was amplified by high-fidelity PCR method, the amplified DNA was partially degraded by DNase I, the degraded DNA was repeatedly denatured and renatured, and then amplified by high-fidelity primerless PCR method; The designed gene primers (5' primer sequence: atgc(a / g / c)ctaca(g / a / t)ctgc, 3' primer sequenc...
Embodiment 2
[0118] Example 2 Expression and purification of recombinant porcine defensin of the present invention
[0119] 1. Expression method
[0120] (1) Expression
[0121] Take the engineering bacteria (positive transformants) obtained in Example 1, put them in 5 ml of BMGY medium, culture them on a shaker at 30°C for 48 hours, and collect the cells by centrifugation; then use the BMMY induction medium to suspend the cells, and induce the cells at 30°C. After culturing for 120h, samples were taken at 12h intervals to detect the antibacterial activity.
[0122] The supernatant of the samples induced to culture for 96h was taken, and the antibacterial activity was tested again, and identified by SDS-PAGE.
[0123] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol;
[0124] BMMY induction medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10 -5 % Biotin, 0.5% ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| wavelength | aaaaa | aaaaa |
| diameter | aaaaa | aaaaa |
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 