Unlock instant, AI-driven research and patent intelligence for your innovation.

Heparinase II deletion mutant coding gene and protein thereof

A technology for deletion of mutants and encoded genes is applied in the field of heparinase II deletion mutants encoding genes and their proteins, and can solve the problems of difficult purification, low soluble heparinase activity, and low expression level.

Inactive Publication Date: 2014-09-03
SHENZHEN HEPALINK PHARMA GRP CO LTD
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Fu Wenbin and others used the pET expression system to realize the recombinant expression of heparanase Ⅱ in Escherichia coli (Fu Wenbin, Yu Xiao et al., Cloning and Expression of Flavobacterium Heparanase Ⅱ, Food and Drugs, 2007, Vol.9: 1-4), the results of SDS-PAGE electrophoresis showed that there were target protein bands, but the expression level was very low, and it was easy to form inclusion bodies, and the activity of soluble heparanase was very low; the activity of heparanase Ⅱ expressed in Su research Improved, but difficult to purify ((Su H, blain F, Musil RA, ZimmermannJ JF, Gu K, Bennett DC. Isolation and Expression in Escherichia coli of hepB and hepC, Genes Coding for the Glycosaminoglycan-Degrading Enzymes Heparinase Ⅱ and Heparinase Ⅲ, Respectively, from Flavobacterium heparinum.Appl.Environ.Microbiol.1996, 62:2723-2734)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Heparinase II deletion mutant coding gene and protein thereof
  • Heparinase II deletion mutant coding gene and protein thereof
  • Heparinase II deletion mutant coding gene and protein thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1. Deletion of the expression of the heparanase II protein HepB-1.

[0025] l. Construction of expression vector pMal-HepB-1.

[0026] For the construction of template PMal-HepB, refer to patent CN 101942024.

[0027] The specific process of constructing the expression vector pMal-HepB-1 is as follows: using the constructed PMAL-HepB as a template, the upstream and downstream primers used are 5' GCCTGAGCTCGCAAACCAAGGCCGATGTG 3 (the bases underlined are the restriction sites of PST I) , 5'-GACTCTGCAGTTAACGATCAACAGTTTCTGAAGTTTTG-3 (bases underlined are SacI restriction sites), respectively introduce PSTI and SacI restriction sites, the amplification reaction system is: 50ng template DNA, 200nmol each primer, 5×PS buffer amplification buffer, 2.5uMol / L of each dNTP, 1 unit of high-retention Pfu enzyme; the amplification program is: denaturation at 95 degrees Celsius for 5 minutes, primer annealing at 50-60 degrees Celsius for 15 seconds, primer extension at 72 deg...

Embodiment 2

[0031] Example 2. Purification of heparanase I protein HepB-1 by amylose column and determination of heparanase I HepB-1 activity.

[0032] 1. Purification of heparanase Ⅱ protein HepB-1 and heparanase Ⅱ HepB-1.

[0033] The fusion partner (fusion partner) maltose binding protein MBP used in the present invention can achieve one-step separation with amylose affinity adsorption. The specific steps of affinity separation are as follows: centrifuge the bacterial solution at 8000rpm for 10min after induction of 0.1mmol IPTG-induced bacterial cells for 20 hours, discard the filtrate and resuspend in 40ml 20mmol Tris. 5s, intermittent time 5s, ultrasonic 200 cycles), 18000rpm.30min centrifugation. After centrifugation, the supernatant was passed through a 20ml pre-equilibrated amylose affinity separation column at 0.5ml / min, eluted and collected by a gradient of 10mM 0.5ml / min maltose.

[0034] The target protein can be eluted with 10 mM maltose at 10 column volumes. The result i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a heparinase II deletion mutant protein and a coding gene thereof. An amino acid sequence of the heparinase II deletion mutant protein provided by the invention is as shown in SEQ ID NO:2. The coding gene of the protein is also within a protective range. According to the invention, a primer is firstly designed by a PCR technology, so that heparinase II deletes a C-terminal amino acid sequence to obtain the heparinase II with smaller molecular weight and higher activity; after the heparinase II is purified, the specific activity of the heparinase II can reach 43.3IU / mg. The heparinase II deletion mutant coding gene and protein thereof disclosed by the invention can be widely applied to producing the heparinase II deletion mutant.

Description

technical field [0001] The invention relates to the genetic engineering transformation of enzymes, in particular to the heparanase II deletion mutant coding gene and its protein. Background technique [0002] Heparanases are a class of polysaccharide-lysing enzymes that act on heparin or heparan sulfate and are found in many microorganisms, including Corynebacterium sp, Bacillus subtilis, Bacillus circulans, Bacteroides faecalis and Flavobacterium heparinus etc., but Flavobacterium heparinus is the only source of commercial heparanase. [0003] The study of heparinase is of great value: heparinase is a polysaccharide lyase, and the study of the interaction between heparinase and its substrate polysaccharide heparin helps to explain the mechanism of action of polysaccharide lyase; heparinase can be used for Analyze the structure and biological functions of complex mucopolysaccharides such as heparin; in addition, heparanase can also be used to analyze the coagulation and ant...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/88C12N15/60C12N1/21
CPCC12N9/2402C12Y302/01019
Inventor 杜宏银马小来李锂
Owner SHENZHEN HEPALINK PHARMA GRP CO LTD