Method for synthetizing D-phenyllactic acid through recombinant Escherichia coli

A technology for recombining Escherichia coli and amino acids, applied in the field of genetic engineering, can solve the problems such as limited production of phenyllactic acid, and achieve the effects of improving affinity, catalytic efficiency, and yield.

Inactive Publication Date: 2014-10-15
CHANGSHU INSTITUTE OF TECHNOLOGY
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The first purpose of the present invention is to provide a recombinant lactate dehydrogenase gene to solve the problem of limited yield of phenylpyruvate catalyzed by existing lactate dehydrogenase to convert phenylpyruvate into phenyllactic acid

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for synthetizing D-phenyllactic acid through recombinant Escherichia coli
  • Method for synthetizing D-phenyllactic acid through recombinant Escherichia coli
  • Method for synthetizing D-phenyllactic acid through recombinant Escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] This example illustrates the construction of pET-28a-ldh.

[0042] Pick a single colony of Lactobacillus plantarum in 10 ml of liquid medium for overnight culture at 30°C and 200 rpm (about 10 h), inoculate the seed culture solution in 10 ml of fresh liquid medium at 1% and cultivate until the late logarithmic period, use Genomic DNA Extraction Kit (Shanghai Sangong Bacteria Genomic DNA Rapid Extraction Kit) was used to extract the genome. Liquid medium (g / L): casein peptone 10, beef extract 10, yeast extract 5, glucose 5, sodium acetate 5, diamine citrate 2, Tween 80 1, KHPO4 2, MgHPO47H2O 0.2, MnSO4H2O 0.05, CaCO3 20, pH 6.8, make up to 1L with distilled water.

[0043] The primer sequences used to construct the expression vector are as follows:

[0044] Upstream primer (including BamHI restriction site): CGC GGATCC ATGAAAATTATTGCATATGC

[0045] Downstream primer (with HindIII restriction site): CCC AAGCTT TTAATCAAACTTAACTTGTG

[0046] Lactate dehydrog...

Embodiment 2

[0051] This example illustrates the construction of pET-28a-ldhY52V.

[0052] Using the extracted and constructed recombinant plasmid pET-28a-ldh as a template and P1 / P2 as primers, PCR was carried out according to the instructions of the site-directed mutagenesis kit, and the reaction product was transformed into competent E. coli JM109, and positive clones were identified by colony PCR and plasmid double-enzyme electrophoresis , and then extract the successfully constructed recombinant plasmid pET-28a-ldhY52A and send it to Sangon for sequencing. After being accurate, it will transform and express the host BL21(DE3) competent, screen positive clones, and express the recombinant strain BL21(DE3). The construction of pET-28a-ldhY52A is completed .

[0053] Using the extracted and constructed recombinant plasmid pET-28a-ldh as a template and P3 / P4 as primers, PCR was performed according to the instructions of the site-directed mutagenesis kit, and the reaction product was trans...

Embodiment 3

[0056] This example illustrates the transformation of whole cells of recombinant Escherichia coli to synthesize phenyllactic acid.

[0057] Pick a single colony of the recombinant bacteria and inoculate it in LB liquid medium containing 50 mg / L kanamycin sulfate, culture overnight (about 9 h) at 37°C and 200 r / min, and inoculate 1% of the culture medium containing the same concentration of cardamycin In the fresh LB medium of namycin, culture at 37°C and 200 r / min until the OD600 is about 0.6-0.8, add IPTG concentration to 0.6 mmol / L, lower the induction temperature to 25°C, and induce at 200 r / min After 5 h, the bacteria were collected by centrifugation, washed twice with pre-cooled pH 7.0 phosphate buffer, and the prepared sludge was used for whole cell transformation.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant lactate dehydrogenase gene. The nucleotide sequence of the gene is represented by SEQ ID NO:1, and tyrosine is mutated into any one of alanine, valine and leucine in the 52 position of the sequence. The invention further relates to recombinant Escherichia coli containing the recombinant lactate dehydrogenase gene and a method for synthetizing D-phenyllactic acid through the recombinant Escherichia coli. According to the method, the tyrosine on a substrate recognition site of D-LDH is replaced by smaller hydrophobic amino acid residue-valine with a site-directed mutagenesis technology, so that the affinity and the catalytic efficiency of the D-LDH to substrate phenylpyruvic acid are improved, after conversion of an expression host, the yield of phenyllactic acid is significantly increased when being compared with that of un-mutated strains, and after whole-cell conversion for 6 h, the yield of the phenyllactic acid is increased from 18 g / L to 24.6 g / L.

Description

technical field [0001] The invention belongs to the field of genetic engineering and relates to a method for synthesizing D-phenyl lactic acid by using recombinant Escherichia coli. Background technique [0002] Phenyllactic acid (PLA), also known as 3-phenyllactic acid or 2-hydroxy-3-phenylpropionic acid, can be used as an ideal food because of its good inhibitory effect on bacteria, fungi and mold Preservatives have received widespread attention. At present, phenyllactic acid is mainly obtained by chemical synthesis or microbial transformation. Chemical synthesis has the disadvantages of high production conditions, complex reaction process, by-products and serious industrial pollution, which makes microbial transformation and synthesis of valuable compounds more conducive to construction. Green sustainable economy. Microorganisms used in the study of phenyllactic acid mainly include Geotrichum candidum, propionic acid bacteria, lactic acid bacteria, and Bacillus, etc. T...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/53C12N9/04C12N1/21C12N15/70C12P7/56C12R1/19
Inventor朱益波王立梅齐斌胡发根朱颖越朱义荣
OwnerCHANGSHU INSTITUTE OF TECHNOLOGY