Transcription factor Asg1p for regulating and controlling acid stress resistance of Candida glabrata

A technology of Torulopsis glabrata and transcription factors, which can be applied in fermentation, genetic engineering, plant genetic improvement, etc., and can solve problems that have not been widely developed

Active Publication Date: 2015-07-01
JIANGNAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the research on acid stress of P. glabrata has not been widely carried out. Proteomic analysis found that P. glabrata has a stronger tolerance to low pH environment than high pH environment.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transcription factor Asg1p for regulating and controlling acid stress resistance of Candida glabrata
  • Transcription factor Asg1p for regulating and controlling acid stress resistance of Candida glabrata
  • Transcription factor Asg1p for regulating and controlling acid stress resistance of Candida glabrata

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] The C.glabrataATCC 2001 (wt) genome was used as a template, and P1 / P2, P3 / P4, and P5 / P6 were used as primers to amplify the left arm (L), uracil Gene (M) and right arm (R), the knockout box CgASG1-LMR was constructed by fusion PCR ( figure 1 A). The starting strain C.glabrataATCC 55 could not be used in MM screening medium (glucose 20g·L) due to the deletion of uracil gene -1 , urea 7g·L -1 , sodium acetate 3g·L -1 , sodium dihydrogen phosphate 5g·L -1 , magnesium sulfate heptahydrate 0.8g·L -1 , agar powder 20g·L -1 ), and the mutant strains grew on MM medium due to the expression of the marker gene uracil after homologous recombination. Perform PCR verification on transformants, such as figure 1 As shown in B, the genome of the transformant was extracted, and it was found that when P7 / P8 was used as the primer, the wild-type strain wt had no bands, but the transformant obtained the left arm of the gene CgURA3 and gene CgASG1 of about 1.8kb. The correct mutant ...

Embodiment 2

[0038] With the C.glabrataATCC 2001 (wt) genome as a template, the amplified gene fragment CgASG1( figure 2 A, 2.5kb) was ligated to plasmid pY13TEF after double enzyme digestion to construct plasmid pY13-CgASG1. The mutant strain Cgasg1Δ cannot grow on the MM selection medium due to the deletion of histidine gene, and the histidine gene on the plasmid pY13TEF can make the complementing strain obtain this growth ability. Colony PCR screening verification found that the mutant strain Cgasg1Δ as a control had no band production, while the transformant was amplified to obtain a specific fragment ( figure 2 B, 2.5kb), this strain was named Cgasg1Δ / CgASG1.

[0039] P9: CGGGATCCATGAACTTGACTGTGCCAC

[0040] P10: CGGAATTCTTAGGCGTTATTAGTAGGTAAAT

Embodiment 3

[0042] Plate growth experiments were performed to analyze the effects of different carbon sources on the growth of strains wt, Cgasg1Δ and Cgasg1Δ / CgASG1, such as image 3 A, The mutant strain Cgasg1Δ showed the same growth condition as the wild-type strain wt on the YNB medium with sodium acetate, sodium citrate, glycerol or ethanol as the sole carbon source, but it grew weakly on the acetic acid medium. Comparing the growth of acetic acid and sodium acetate as the only carbon source, it was found that the reason for the weak growth when acetic acid was used as the carbon source was the pH drop caused by acetic acid. Further changing the pH of the YNB medium, the growth of the strain is as follows image 3 B, It was found that the growth of the mutant strain Cgasg1Δ was inhibited at pH 3.0 and could not grow at pH 2.0; while the complementing strain Cgasg1Δ / CgASG1 showed the same growth phenotype as the wild-type strain wt on any medium. The cell viability of the strain wt a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a transcription factor Asg1p for regulating and controlling the acid stress resistance of Candida glabrata and belongs to the field of bioengineering. According to the invention, a gene-deleted mutant strain Cgasg1 Deta and a gene supplemented strain Cgasg1 Deta / CgASG1 are constructed by transforming Candida glabrata and then are subjected to a plate growth experiment and a cell viability test, the intracellular microenvironment of Candida glabrata is evaluated by analyzing the activity of intracellular h<+>-ATPase, intracellular Ph and the content of intracellular ROS under acid stress, and results show that Asg1p is a necessary transcription factor for Candida glabrata to resist acid stress.

Description

technical field [0001] The invention relates to a transcription factor Asg1p regulating the acid stress resistance ability of Toruula glabrata, belonging to the field of bioengineering. Background technique [0002] Candida glabrata is the only microorganism that produces pyruvate industrially. In addition, C.glabrata can also be used for industrial production of fumaric acid, malic acid, α-ketoglutaric acid and other organic acids. During organic acid fermentation, with the accumulation of products, the pH of the medium decreases rapidly, resulting in the slowdown or even stop of the growth of bacteria and the accumulation of products. In recent years, strategies such as adding exogenous auxiliary substrates, mutation breeding, genetic engineering and adaptive evolution have been used to improve the acid tolerance and organic acid production of bacteria at home and abroad. Research on the acid resistance mechanism of C.glabrata can fundamentally solve this problem, but th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/31C12N1/19C12P7/46C12P7/50C12R1/72
Inventor刘立明吴静陈坚
OwnerJIANGNAN UNIV