Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Biological adhesive as well as preparation method and application thereof

A bio-adhesive and solvent technology, applied in the field of biomedical materials, can solve problems such as unreported, and achieve the effects of low preparation cost, high yield and strong adhesion performance

Active Publication Date: 2015-11-11
NAT UNIV OF DEFENSE TECH
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Japanese scientists used genetic engineering to express the colloidal proteins cp19k and cp20k in the red giant barnacle, and researchers from Xiamen University expressed the cp20k protein of the white ridge barnacle and conducted functional studies, indicating that cp20k can selectively adhere to metals and other matrix materials, and cp19k plays a key role in underwater adhesion, and can adhere to the surface of materials with different physical and chemical characteristics underwater, but currently it is not effective for white-ridge barnacles Balcp19k The cloning and expression of the gene and the study of its adhesion performance have not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biological adhesive as well as preparation method and application thereof
  • Biological adhesive as well as preparation method and application thereof
  • Biological adhesive as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] A bioadhesive of the present invention includes Trx-Balcp19k fusion protein. The nucleotide sequence of the Trx-Balcp19k protein is shown in SEQ ID NO.1, specifically:

[0055] ATGAGCGATAAAATTATTCACCTGACTGACGACAGTTTTGACACGGATGTACTCAAAGCGGACGGGGCGATCCTCGTCGATTTCTGGGCAGAGTGGTGCGGTCCGTGCAAAATGATCGCCCCGATTCTGGATGAAATCGCTGACGAATATCAGGGCAAACTGACCGTTGCAAAACTGAACATCGATCAAAACCCTGGCACTGCGCCGAAATATGGCATCCGTGGTATCCCGACTCTGCTGCTGTTCAAAAACGGTGAAGTGGCGGCAACCAAAGTGGGTGCACTGTCTAAAGGTCAGTTGAAAGAGTTCCTCGACGCTAACCTGGCCGGTTCTGGTTCTGGCCATATGCACCATCATCATCATCATTCTTCTGGTCTGGTGCCACGCGGTTCTGGTATGAAAGAAACCGCTGCTGCTAAATTCGAACGCCAGCACATGGACAGCCCAGATCTGGGTACCGACGACGACGACAAGGCCATGGCTGATATCGGATCCGAATTCGTGCCCCCACCGTGCGACCTCAGCATCAAATCCAAGCTGAAGCAGGTAGGCGCGACGGCCGGCAACGCGGCCGTCACCACCACCGGCACCACCAGCGGCTCCGGCGTGGTTAAGTGCGTGGTGCGCACGCCCACCTCGGTCGAGAAGAAGGCCGCCGTCGGCAACACAGGTCTCAGCGCGGTCAGTGCTTCCGCCGCCAACGGCTTCTTCAAAAATCTCGGCAAGGCCACCACAGAGGTGAAAACTACCAAAGACGGCACCAAAGTGAAGACGAAAACCGCTGGCAAAGGGAAAACTGGCGGTACGGC...

Embodiment 2

[0117] The Trx-Balcp19k protein freeze-dried powder in Example 1 was dissolved in 5% acetic acid to prepare a bioadhesive with a concentration of 1.33 mg / mL.

[0118] The bioadhesive of embodiment 2 is carried out viscosity test:

[0119] Determination of the adhesion properties of bioadhesives on glass slides and polystyrene cell culture dishes:On the cleaned hydrophilic glass slides and hydrophobic polystyrene cell culture dishes, add 5 μL of the bioadhesive of Example 2 dropwise, and add bovine serum albumin (BSA) of equal volume and concentration at the same time Negative and positive controls were carried out with Cell-Tak, respectively. After the bioadhesive of Example 2 is adsorbed and dried in the air, it is first rinsed with pure water, and then stained with Coomassie Brilliant Blue R-250 (2g Coomassie Brilliant Blue R-250, dissolved in 500ml methanol, then dissolved in 100ml Acetic acid, finally add water to make up 1L) for staining, rinse with decolorizing soluti...

Embodiment 3

[0124] Take 5 mg of the Trx-Balcp19k protein freeze-dried powder of Example 1, add a small amount of deionized water dropwise to moisten it, and prepare a wet colloidal bioadhesive.

[0125] The bioadhesive of embodiment 3 is bonded to non-physiological materials (engineering plastics): On the surface of the bacterial culture dish made of engineering plastics, add a small amount of bio-adhesive of Example 3, then buckle the tips of pipette guns of different sizes upside down on the adhesive and squeeze it gently, and place it on a horizontal table After drying overnight in air, test for adhesion results. Bonding result reference Figure 9 :from Figure 9 It can be observed that the tip of the gun has been firmly adsorbed on the surface of the Petri dish.

[0126] Bonding the bioadhesive of Example 3 to a non-physiological material (aluminum sheet):

[0127] see Figure 10 : (1) Cut a 1mm thick aluminum plate into an aluminum strip with a width of 100mm×10mm, and then p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a biological adhesive as well as a preparation method and application thereof. The biological adhesive comprises Trx-Balcp19k protein, and the nucleotide sequence of the Trx-Balcp19k protein is as shown in SEQ ID NO. 1. The preparation method of the biological adhesive comprises the steps of reverse transcription, amplification, recombinant plasmid construction, conversion, induction, affinity chromatography, dialysis and the like. The biological adhesive disclosed by the invention has strong adhesion property, relatively high yield and low preparation cost and can be applied to adhesion between physiological materials, between non-physiological materials as well as between physiological materials and non-physiological materials.

Description

technical field [0001] The invention relates to the technical field of biomedical materials, in particular to a bioadhesive and its preparation method and application. Background technique [0002] Medical adhesives have many uses in the fields of medical devices, including the sealing and repair of human and animal active tissue wounds, the sealing and hemostasis of surgical wounds, the adhesion between active physiological tissues, and the adhesion between active physiological tissues and non-physiological materials wait. Medical adhesives can be divided into chemical adhesives and biological adhesives according to material properties. Although chemical adhesives such as a-cyanoacrylates have been used clinically for many years, the toxicity of their degradation products is unavoidable. Bioadhesives such as fibrin glue are a kind of medical wound sealant. They are protein biological products extracted from human or animal plasma. They are mainly used in surgical wounds t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61L24/10C09J189/00C07K19/00C12N15/62C12N15/70C07K1/22
Inventor 胡碧茹曾玲吴文健刘志明李韵秋
Owner NAT UNIV OF DEFENSE TECH
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com