Preparation method and application of congea chinensis extract
A technology of extract and velvet, which is applied in the field of medicine to achieve the effect of high-efficiency drugs and simple and fast preparation methods
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Embodiment 1: the preparation of the active component of Chinese velvet vine extract
[0028] In December 2014, a 1kg sample of the above-ground part of Yunnan Huarongbao rattan was collected from Pingbian Miao Autonomous County, Yunnan Province. The plant species name was identified by a researcher at the Institute of Medicinal Plants, Yunnan Academy of Agricultural Sciences, and the crude drug specimens were deposited in the Institute of Medicinal Plants, Yunnan Academy of Agricultural Sciences. Place.
[0029] A preparation method for obtaining an active component with significant anti-tumor activity from the plant Cinnamon chinensis, the specific steps are:
[0030] (1) Crushing and extraction
[0031] Dry and pulverize 1kg of the aerial part of the vine of Yunnan medicinal plant Huaronghua, extract it with 10L methanol (pharmaceutical grade) at room temperature for 5 days (occasionally shaking), concentrate the filtrate with suction, and then use ethyl acetate (40...
Embodiment 2
[0035] Example 2: Example 1 Active Components of the Extract of Cinnamon chinensis Activating p53 - / - - GFP fluorescence experiment in p53-GFPMEF cells, the specific experimental operation is as follows:
[0036] (1) Construction of p53-GFP-reporter vector, the specific method is as follows:
[0037] 1) Cut the GFP reporter gene from pAcGFP1-N1 plasmid (purchased from Clontech) using BgLII and NotI double enzyme digestion, and replace the Luciferase reporter gene in pGL4.82 (purchased from Promega) to produce pGL4-GFP carrier;
[0038] 2) Design primers for the promoter region of the p53 gene (5'TGGCTCGAGGTCTTTACAGAGAGTG3', 5'CGAGATCTCGGAGAAGCGTGACA3') to amplify the promoter sequence and connect it into the pGL4-GFP vector, thus obtaining a reporter vector fused with the p53 gene promoter and GFP --- --p53-GFP-reporter vector;
[0039](2) Transfer the p53 gene promoter and GFP fusion reporter vector into mouse fibroblasts (MEF), the specific method is as follows:
[00...
Embodiment 3
[0050] Example 3: The active components of the extract of Huaronghuateng in Example 1 have obvious killing effect on tumor cells, but weaker killing effect on normal cells (WT-MEF cells)
[0051] SRB (SulforhodamineB, SRB) is a pink anion-binding dye; it can specifically bind to basic amino acids in biological macromolecules in living cells, and its absorbance value is measured by an enzyme-linked detector at a wavelength of 540nm, and the size of the absorbance value is the relative number of viable cells. Compared with MTT, SRB staining is not easy to change color and has better stability. Cells can be stored for a long time after being fixed and dissolved with Tris-base, so the absorbance value will not be greatly affected. In addition, because of the elution process involved in the determination of pigmented drugs, the influence of pigments can be largely eliminated. In this experiment, SRB was used to detect the effect of the active components of the extract of Huaronghu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 