Unlock instant, AI-driven research and patent intelligence for your innovation.

Preparation method and application of congea chinensis extract

A technology of extract and velvet, which is applied in the field of medicine to achieve the effect of high-efficiency drugs and simple and fast preparation methods

Active Publication Date: 2015-12-09
KUNMING UNIV OF SCI & TECH +1
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no report about the anti-tumor activity of the active components of the extract of Huarongbaoteng

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of congea chinensis extract
  • Preparation method and application of congea chinensis extract
  • Preparation method and application of congea chinensis extract

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1: the preparation of the active component of Chinese velvet vine extract

[0028] In December 2014, a 1kg sample of the above-ground part of Yunnan Huarongbao rattan was collected from Pingbian Miao Autonomous County, Yunnan Province. The plant species name was identified by a researcher at the Institute of Medicinal Plants, Yunnan Academy of Agricultural Sciences, and the crude drug specimens were deposited in the Institute of Medicinal Plants, Yunnan Academy of Agricultural Sciences. Place.

[0029] A preparation method for obtaining an active component with significant anti-tumor activity from the plant Cinnamon chinensis, the specific steps are:

[0030] (1) Crushing and extraction

[0031] Dry and pulverize 1kg of the aerial part of the vine of Yunnan medicinal plant Huaronghua, extract it with 10L methanol (pharmaceutical grade) at room temperature for 5 days (occasionally shaking), concentrate the filtrate with suction, and then use ethyl acetate (40...

Embodiment 2

[0035] Example 2: Example 1 Active Components of the Extract of Cinnamon chinensis Activating p53 - / - - GFP fluorescence experiment in p53-GFPMEF cells, the specific experimental operation is as follows:

[0036] (1) Construction of p53-GFP-reporter vector, the specific method is as follows:

[0037] 1) Cut the GFP reporter gene from pAcGFP1-N1 plasmid (purchased from Clontech) using BgLII and NotI double enzyme digestion, and replace the Luciferase reporter gene in pGL4.82 (purchased from Promega) to produce pGL4-GFP carrier;

[0038] 2) Design primers for the promoter region of the p53 gene (5'TGGCTCGAGGTCTTTACAGAGAGTG3', 5'CGAGATCTCGGAGAAGCGTGACA3') to amplify the promoter sequence and connect it into the pGL4-GFP vector, thus obtaining a reporter vector fused with the p53 gene promoter and GFP --- --p53-GFP-reporter vector;

[0039](2) Transfer the p53 gene promoter and GFP fusion reporter vector into mouse fibroblasts (MEF), the specific method is as follows:

[00...

Embodiment 3

[0050] Example 3: The active components of the extract of Huaronghuateng in Example 1 have obvious killing effect on tumor cells, but weaker killing effect on normal cells (WT-MEF cells)

[0051] SRB (SulforhodamineB, SRB) is a pink anion-binding dye; it can specifically bind to basic amino acids in biological macromolecules in living cells, and its absorbance value is measured by an enzyme-linked detector at a wavelength of 540nm, and the size of the absorbance value is the relative number of viable cells. Compared with MTT, SRB staining is not easy to change color and has better stability. Cells can be stored for a long time after being fixed and dissolved with Tris-base, so the absorbance value will not be greatly affected. In addition, because of the elution process involved in the determination of pigmented drugs, the influence of pigments can be largely eliminated. In this experiment, SRB was used to detect the effect of the active components of the extract of Huaronghu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method for an active extract extracted from a Yunnan featured plant, namely, congea chinensis. The extract is obtained through organic solvent digestion, extraction and open chromatograph group separation, has remarkable antitumor activity, and can targetedly activate tumor inhibiting gene p53; besides, the extract has no obvious toxicity on normal cells, which shows that the novel active extract component of the Yunnan featured plant, namely, congea chinensis has high application potential in preparation of low-toxicity, efficient, antitumor and personalized treating medicine.

Description

technical field [0001] The invention belongs to the field of medicine, and in particular relates to a Yunnan characteristic plant Huarongbuteng ( Congeachinensis ) preparation method of the extract and its application in the preparation of selective anti-tumor therapeutic drugs. Background technique [0002] Tumor is a kind of fatal disease that seriously threatens human health. Its pathogenesis has not been fully elucidated, and the treatment effect is not satisfactory. Most of the drugs currently routinely used in tumor therapy are designed for the regulation of DNA replication or cytoskeleton in the process of cell proliferation. While these drugs kill rapidly proliferating tumor cells, they are also highly toxic to normal proliferating cells (such as bone marrow stem cells, etc.) On the contrary, the resistance of the tumor decreases, and it is difficult to obtain a good therapeutic effect. Therefore, using molecular targeted screening technology, targeting tumor cell...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K36/85A61P35/00
Inventor 罗瑛李晚谊刘静张继虹黄文卉潘俊李智敏唐文如贾舒婷吴晓明周若宇盛苗苗
Owner KUNMING UNIV OF SCI & TECH