Engineered strain of saccharomyces cerevisiae capable of efficiently expressing eriocheir sinensis anti-lipopolysaccharide factor
An anti-lipopolysaccharide factor, Chinese mitten crab technology, applied in the biological field, can solve the problems of increasing industrial production cost, low output rate, no ALF expression of Chinese mitten crab, etc., and achieves the goal of promoting healthy growth and enhancing resistance. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Embodiment 1: the construction of Saccharomyces cerevisiae genetically engineered bacteria (gene cloning)
[0031]By constructing the high-expression plasmid pHAC181-EsALF, the specific method is to extract the tissue RNA of Chinese mitten crab, and the reverse transcription kit reverse-transcribes the RNA into cDNA. Use high-fidelity enzymes to carry out PCR amplification of the target gene fragment EsALF, the EsALF gene fragment (CDS region, excluding the stop codon, a total of 360bp), and then clone this fragment into the multiple cloning site of the high-expression plasmid pHAC181, and finally correct the DNA sequencing was carried out to verify that the sequence was not mutated, and the recombinant high-expression plasmid pHAC181-EsALF was obtained.
Embodiment 2
[0032] Embodiment 2: the construction of Saccharomyces cerevisiae genetically engineered bacteria (homologous recombination)
[0033] Homologous recombination primers were designed based on the constructed recombinant high-expression plasmid pHAC181-EsALF, and the plasmid pHAC181-EsALF was amplified using high-fidelity PrimeSTARGXL enzyme, and the successfully amplified long fragment was integrated into the downstream of the GAL1 promoter in Saccharomyces cerevisiae.
[0034] Homologous recombination primers are F1 and R1, and the sequences are shown in SEQ ID NO.3 and SEQ ID NO.4:
[0035] F1: caaatgtaataaaagtatcaacaaaaaattgttaatatacctctatactttaacgtcaaggagaaaaaacccggatctcaaa
[0036] ATGGCACGCCTGTCGCTG
[0037] R1: tatggacgaggtaataaggaaactcagaaccagaatagtggcatgagctctccaatttaacatatttgccattagtgacc
[0038] CGATGATAAGCTGTCAAACATG
[0039] The specific steps of gene homologous recombination (integration) are:
[0040] 1. Pick a single colony of the activated GAL1-ScRCH1 strain...
Embodiment 3
[0054] Example 3: Engineering strain protein expression and WESTERNBLOT detection
[0055] A single colony of the Gal-pHAC181-EsALF strain with successful homologous recombination was inoculated in 5ml of SD-LEU medium for overnight culture, and the culture was transferred to 45mL of LYPG medium the next day, and induced by galactose for 6h (OD detected as 1.2 -1.5) After that, extract the strain protein. The extracted protein was used for WESTERNBLOT detection.
[0056] The specific steps are:
[0057] (1) Extraction of total protein in cells
[0058] 1. Pick a single colony and culture it overnight at 30°C in the desired liquid medium until saturated;
[0059] 2. Take 5 mL of the overnight cultured bacterial solution and add 45 mL of fresh liquid medium, and shake it in a shaker at 30°C for about 6 hours (OD=1.2-1.5) (rotation speed: 220rmp);
[0060] 3. Collect the bacteria at 8000rpm1min, and remove the upper liquid;
[0061] 4. Resuspend the bacteria with pre-cooled ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More