Check patentability & draft patents in minutes with Patsnap Eureka AI!

A kind of monoclonal antibody and its application

A monoclonal antibody and antibody technology, applied in the direction of antibodies, antibody medical components, antiviral agents, etc., can solve the problems of time-consuming and labor-consuming, complicated operation, interference with PCV2 infection detection, etc., to reduce false positive results and shorten detection time , the effect of reducing the false positive detection rate

Active Publication Date: 2020-03-10
LUOYANG PULIKE WANTAI BIOTECH
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Currently, PCV2 antibody detection methods include immunoperoxidase monolayer assay (IPMA), indirect immunofluorescence assay (IFA), enzyme-linked immunosorbent assay (ELISA), but IPMA and IFA cannot distinguish the antigenic cross-reactivity of PCV1 and PCV2 , and the operation is complicated, time-consuming and labor-intensive; the existing ELISA kits include foreign kits (PCV2ELISASK105 of the Netherlands Biochek Company, PCV2ELISA of the Korean Jinnuo Company) and domestic kits (based on indirect ELISA antibody detection kits, such as China PCV2 ELISA antibody detection kit from Animal Health and Epidemiology Center, PCV2-dCap-ELISA antibody detection kit from Zhejiang University), none of these kits can distinguish the problem of PCV1 cross-antibody
[0004] Clinically, PCV1 and PCV2 are often co-infected. Although PCV1 does not cause disease, it will interfere with the detection of PCV2 infection.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of monoclonal antibody and its application
  • A kind of monoclonal antibody and its application
  • A kind of monoclonal antibody and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0030] As an embodiment of the present invention, the antibody is monoclonal antibody PCV2-McAB2, the amino acid sequence of the heavy chain variable region of the monoclonal antibody PCV2-McAB2 is SEQ ID No.2, and / or the light chain variable region The amino acid sequence of the region is SEQ ID No.4.

[0031] The monoclonal antibody PCV2-McAB2 is an anti-porcine circovirus type 2 monoclonal antibody 3H11, and its relative affinity constant is 7.81ng / ml, that is to say, the binding strength of the monoclonal antibody 3H11 to the epitope of the antigen Moderate; the neutralizing antibody titer of the monoclonal antibody 3H11 is greater than 1:512, which means that the monoclonal antibody 3H11 has good neutralizing activity and can inhibit the superinfection of target cells by porcine circovirus type 2.

[0032] The term "immunizing amount" when understood as "prophylactically effective amount" means an amount sufficient to elicit an immune protective response in a vaccinated i...

Embodiment 1

[0091] Embodiment 1 Preparation, purification, identification and inspection of anti-porcine circovirus type 2 monoclonal antibody

[0092] 1.1 Preparation, purification and content determination of PCV2Cap whole protein

[0093] Primer pair Cap- F: 5'CATATGATGACGTATCCAAGGAGGC3', Cap-R: 5'CTCGAGTTAAGGGTTAAGTGGGGGGT3'. According to Li Tingdong (Li Tingdong, expression of rotavirus structural protein in Escherichia coli and its in vitro assembly of virus-like particles, 2009) literature, prokaryotic expression of PCV2Cap whole protein was carried out, and purified by ion exchange chromatography, using 12% SDS-PAGE was used to identify the protein by electrophoresis, and the result: the molecular weight of the obtained protein was in line with the expectation. The purified protein sample was dialyzed in 1×PBS (pH7.4) overnight, and the dialyzed sample was quantified according to the instructions of Beyontian BCA Protein Quantification Kit. The results showed that the concentrat...

Embodiment 2

[0135] Example 2 Preparation, Quality Research and Application of Porcine Circovirus Type 2 Antibody Detection Kit

[0136] 2.1 Preparation of antibody detection kit

[0137] Get the porcine circovirus nucleocapsid protein Cap protein prepared in Example 1, dilute it to 2.0 μg / ml with PB solution (0.02mol / L, pH value 7.4), coat the enzyme plate overnight at 2~8°C, discard the bag By liquid. Add 200 μl of PB solution (0.02 mol / L, pH 7.4) containing 20% ​​calf serum to each well, block at 37° C. for 2 hours, and discard the blocking solution. After drying the ELISA plate at 25-37°C for 16-24 hours, put it into an aluminum foil bag one by one, and put a bag of desiccant at the same time, and heat seal the bag. Assemble the enzyme-labeled plate, positive control, negative control, enzyme-labeled monoclonal antibody, concentrated washing solution, chromogenic reagent A solution, chromogenic reagent B solution, and stop solution. When testing, add 50 μl of the sample to be tested...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a monoclonal antibody and application thereof. The monoclonal antibody is a monoclonal antibody 3H11 for resisting the porcine circovirus type 2, is mainly used for a porcine circovirus type 2 antibody detecting kit with the monoclonal antibody 3H11, an antigen detection kit and a medicine composition, and belongs to the field of biological medicine. Infection of the PCV1 and infection of the PCV2 can be distinguished through the antibody detecting kit, so the immunity state of pig groups can be conveniently monitored in real time, and an important effect for preventing infection of the PCV2 is achieved. By means of the antigen detection kit, PCV2 antigens in a sample can be detected, the false positive rate is decreased, and important significance for controlling infection of the PCV2 is achieved. By means of the monoclonal antibody 3H11, porcine circovirus diseases can be prevented and / or treated, and the simplex prevention effect of existing vaccines is achieved.

Description

technical field [0001] The invention relates to an anti-porcine circovirus type 2 monoclonal antibody, a pharmaceutical composition containing the monoclonal antibody, an antibody detection kit, an antigen detection kit and other applications, belonging to the field of biomedicine. Background technique [0002] Porcine circovirus (Circoviridae, Circovirus, Porcine circovirus, PCV) is the smallest animal virus found so far, with a diameter of about 17nm, a circular, single-stranded DNA virus, and two serotypes, PCV1 and PCV2. Among them, PCV1 is not pathogenic; PCV2 is pathogenic and can cause a series of porcine circovirus diseases (PCVD) including postweaning multisystem wasting syndrome (Postweaning Multisystcmic Wasting Syndrome, PMWS), piglet A2 congenital tremor (A2CT), porcine reproductive disorder, porcine dermatitis nephritic syndrome (PDNS), proliferative necrotizing pneumonia (PNP) and respiratory disease syndrome (PRDS), especially the main pathogens of PMWS. PMW...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/08A61K39/42A61P31/20G01N33/577G01N33/569G01N33/558
CPCA61K2039/505A61K2039/542C07K16/081C07K2317/56G01N33/558G01N33/56983G01N33/577
Inventor 田克恭韩水仲
Owner LUOYANG PULIKE WANTAI BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More