A kind of monoclonal antibody and its application
A monoclonal antibody and antibody technology, applied in the direction of antibodies, antibody medical components, antiviral agents, etc., can solve the problems of time-consuming and labor-consuming, complicated operation, interference with PCV2 infection detection, etc., to reduce false positive results and shorten detection time , the effect of reducing the false positive detection rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment approach
[0030] As an embodiment of the present invention, the antibody is monoclonal antibody PCV2-McAB2, the amino acid sequence of the heavy chain variable region of the monoclonal antibody PCV2-McAB2 is SEQ ID No.2, and / or the light chain variable region The amino acid sequence of the region is SEQ ID No.4.
[0031] The monoclonal antibody PCV2-McAB2 is an anti-porcine circovirus type 2 monoclonal antibody 3H11, and its relative affinity constant is 7.81ng / ml, that is to say, the binding strength of the monoclonal antibody 3H11 to the epitope of the antigen Moderate; the neutralizing antibody titer of the monoclonal antibody 3H11 is greater than 1:512, which means that the monoclonal antibody 3H11 has good neutralizing activity and can inhibit the superinfection of target cells by porcine circovirus type 2.
[0032] The term "immunizing amount" when understood as "prophylactically effective amount" means an amount sufficient to elicit an immune protective response in a vaccinated i...
Embodiment 1
[0091] Embodiment 1 Preparation, purification, identification and inspection of anti-porcine circovirus type 2 monoclonal antibody
[0092] 1.1 Preparation, purification and content determination of PCV2Cap whole protein
[0093] Primer pair Cap- F: 5'CATATGATGACGTATCCAAGGAGGC3', Cap-R: 5'CTCGAGTTAAGGGTTAAGTGGGGGGT3'. According to Li Tingdong (Li Tingdong, expression of rotavirus structural protein in Escherichia coli and its in vitro assembly of virus-like particles, 2009) literature, prokaryotic expression of PCV2Cap whole protein was carried out, and purified by ion exchange chromatography, using 12% SDS-PAGE was used to identify the protein by electrophoresis, and the result: the molecular weight of the obtained protein was in line with the expectation. The purified protein sample was dialyzed in 1×PBS (pH7.4) overnight, and the dialyzed sample was quantified according to the instructions of Beyontian BCA Protein Quantification Kit. The results showed that the concentrat...
Embodiment 2
[0135] Example 2 Preparation, Quality Research and Application of Porcine Circovirus Type 2 Antibody Detection Kit
[0136] 2.1 Preparation of antibody detection kit
[0137] Get the porcine circovirus nucleocapsid protein Cap protein prepared in Example 1, dilute it to 2.0 μg / ml with PB solution (0.02mol / L, pH value 7.4), coat the enzyme plate overnight at 2~8°C, discard the bag By liquid. Add 200 μl of PB solution (0.02 mol / L, pH 7.4) containing 20% calf serum to each well, block at 37° C. for 2 hours, and discard the blocking solution. After drying the ELISA plate at 25-37°C for 16-24 hours, put it into an aluminum foil bag one by one, and put a bag of desiccant at the same time, and heat seal the bag. Assemble the enzyme-labeled plate, positive control, negative control, enzyme-labeled monoclonal antibody, concentrated washing solution, chromogenic reagent A solution, chromogenic reagent B solution, and stop solution. When testing, add 50 μl of the sample to be tested...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


