Heat-resistant xylanase and application thereof

A technology for xylanase and xylanase activity, which is applied to heat-resistant xylanase and its application fields, can solve the problems of reducing enzyme recycling rate and the like, and achieves excellent properties, strong thermal stability, and thermal stability. improved effect

Active Publication Date: 2016-06-15
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In industrial production, the carbohydrate-binding module of xylanase binds irreversibly to the substrate, reducing the recycling rate of the enzyme

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Heat-resistant xylanase and application thereof
  • Heat-resistant xylanase and application thereof
  • Heat-resistant xylanase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Embodiment 1, the acquisition of xylanase XynA, TM1, TM1-M and the construction of its prokaryotic expression vector

[0024] The cloning process of the gene and the construction process of its prokaryotic expression vector comprise the following steps:

[0025] 1. Cloning of xylanase gene

[0026] The following primers were designed for the xylanase XynA gene:

[0027] XynA-F:CAAGCAGCCATAACACTCACAT

[0028] XynA-R:TTATTCAATCAACAAATAATCTGCAT

[0029] The following primers were designed for the xylanase TM1 gene:

[0030] TM1-F:CAAGCAGCCATAACACTCACAT

[0031] TM1-R:CGTTGTAGTTGGCGTAGTTGAA

[0032] The following primers were designed for the xylanase TM1-M gene:

[0033] TM1-M-F:CAAACCAGCATAACACTCACATCAAATGCAA

[0034] TM1-M-R:CGTTGTAGTTGGCGTAGTTGAA

[0035] Using the genomic DNA of Thermocellulolyticus saccharolyticum preserved in China General Microbiological Culture Collection (CGMCC) with the preservation number CGMCC1.5183 and the preservation date in March 20...

Embodiment 2

[0092] Embodiment 2, expression and purification of xylanase XynA, TM1, TM1-M

[0093] The prokaryotic expression vectors pEASY-E1-xynA, pEASY-E1-tm1 and pEASY-E1-tm1-m containing xylanase XynA, TM1 and TM1-M genes obtained in Example 1 were transformed into Escherichia coli E.coliBL21 ( DE3), select positive single clones respectively, and shake the positive single clones to OD at 37°C 600 After reaching 0.5, add IPTG with a final concentration of 1mM, induce at 16°C for 16 hours, collect the respective bacterial cells by centrifugation, and add 4ml of phosphate buffered saline (50mM NaH 2 PO 4 , 300mMNaCl, pH8.0), and 0.04ml of 100× protease inhibitor, lysozyme (final concentration 1mg / ml) was added at the same time to fully suspend the bacterial cells and then break the cells by ultrasonic method. The resulting cell disruptions were centrifuged at 4°C and 10,000×g for 20 minutes, and the respective supernatants were filtered through a 0.22 μm filter membrane to become the...

Embodiment 3

[0095] Embodiment 3, enzymatic characteristic detection

[0096] The xylanases XynA, TM1 and TM1-M obtained by the above method were subjected to the following reactions respectively for identification of enzymatic characteristics:

[0097] 1. Determination of specific enzyme activity of xylanase

[0098] Utilize the recombinant xylanase of above-mentioned purification, carry out following reaction:

[0099] Take 50 μl each of the 0.8 μg / ml xylanase XynA solution, 0.4 μg / ml truncated protein TM1 solution and 0.4 μg / ml mutant protein TM1-M solution obtained above, and add them to 100 μl 1% Xylan solution, wherein xylan was dissolved in PC buffer (PC buffer is 50mM phosphoric acid, 12mM citric acid, pH6.5), and reacted at 75°C for 10 minutes. The amount of reducing sugar produced after the reaction was determined by 3.5-dinitrosalicylic acid (DNS) method.

[0100] After the above reaction, add 200 μl of DNS solution, boil for 5 minutes, add 650 μl of water after cooling and m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Theoretical molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to xylanase and particularly provides a heat-resistant xylanase and an application thereof. The heat-resistant xylanase can be: (a) a nucleic acid for encoding a polypeptide having xylanase activity, wherein a sequence of the protein that is encoded by the nucleic acid is represented as the amino sequence in SEQ ID No.2 (TM1); (b) a nucleic acid for encoding a polypeptide having xylanase activity, wherein the nucleic acid has a sequence having more than 80% homology with the SEQ ID No.2; or (c) a lacked signal sequence or a carbohydrate combination module of the xylanase that encoded by the nucleic acid in the (a) or (b). The xylanase TM1 and TM1-M has huge potential value in the applications of feeds, foods and pulping and papermaking industry.

Description

technical field [0001] The invention relates to xylanase, in particular to a heat-resistant xylanase and its application. Background technique [0002] Hemicellulose, an important component of plant cell walls, is the second most abundant polysaccharide in nature, and its main component is xylan. The composition of xylan is complex, the main chain is composed of xylopyranose residues linked by β-1,4 glycosidic bonds, and its side chains can be replaced by arabinose, glucuronic acid, acetyl groups, etc. The main function of β-1,4-endo-xylanase (Endo-β-1,4-xylanase, EC3.2.1.8) is to randomly cut off β-1,4 glycosidic bonds from inside the xylan chain to form Xylooligosaccharides with different degrees of polymerization. Xylanase exists widely in nature and is found in bacteria, fungi, actinomycetes, algae, and protozoa. According to the protein amino acid sequence, it can be divided into different glycoside hydrolase families, and xylanase mainly exists in the 5th, 7th, 8th,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/42C12N15/70C12N1/21C12R1/19
Inventor李福利孟冬冬吕明张坤迪
OwnerQINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI