Unlock instant, AI-driven research and patent intelligence for your innovation.

Construction method for double enzyme digestion simplified genome next generation sequencing library and matched kit

A technology for a second-generation sequencing library and a construction method, which is applied in the field of supporting kits for the construction of second-generation sequencing libraries, can solve the problems of cumbersome process, restricted library construction cost, and high time consumption, and achieves simplified library construction process, reduced synthesis cost, The effect of increasing flexibility

Inactive Publication Date: 2016-06-22
KUNMING INST OF BOTANY - CHINESE ACAD OF SCI
View PDF3 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although ddRAD simplifies the library construction process to a certain extent compared to RAD, it still includes 11 steps, so the experiment takes a long time
At the same time, ddRAD performs double enzyme digestion on genomic DNA by combining a rare enzyme with a common enzyme. This combination is based on the consideration of the number of fragments produced by enzyme digestion, but it limits the choice of enzymes.
In addition, the experimental process uses magnetic beads to purify DNA and DNA fragment automatic recovery equipment to select fragments. The magnetic frame and DNA fragment automatic recovery instrument Pippin-Prep required for magnetic bead purification are relatively expensive test consumables and instruments. Ordinary molecules Labs are difficult to configure
In addition, the single-stranded oligonucleotides for the synthesis of P1 and P2 linkers require high-performance liquid chromatography (HPLC) purification and terminal phosphorylation, and the cost of synthesizing P1 and P2 linkers alone will be unaffordable for ordinary laboratories
Further, the lengths of the 48 barcode sequences provided by the ddRAD technical process are exactly the same, which will cause a serious imbalance in the bases of the restriction site, which will lead to a decrease in the quality of the sequencing at this position, and it is impossible to judge whether the library digestion is complete or not based on the quality value. asterisk activity
A large amount of time consumption and relatively high database construction costs seriously restrict the wide application of ddRAD
Therefore, it is still necessary to improve the existing ddRAD simplified genome sequencing library construction method to overcome the shortcomings of the existing method, such as limited range of enzyme selection, complex use of instruments, cumbersome process, high cost and low quality of base sequencing at the restriction site. , improve sequencing efficiency and enable library construction to be implemented smoothly in small and medium-sized laboratories with 5-10 people and insufficient funds, without relying on large regional instrument centers or sequencing centers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method for double enzyme digestion simplified genome next generation sequencing library and matched kit
  • Construction method for double enzyme digestion simplified genome next generation sequencing library and matched kit
  • Construction method for double enzyme digestion simplified genome next generation sequencing library and matched kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0136] Double enzyme digestion simplifies the basic operation process of genome next-generation sequencing library construction:

[0137] The first step, the extraction of genomic DNA: using the improved CTAB method to extract the genomic DNA of fresh young bamboo leaves,

[0138] The second step, enzyme digestion of genomic DNA: use two common restriction endonucleases to digest genomic DNA to obtain DNA fragments with corresponding restriction enzyme sites at both ends;

[0139] The genomic DNA has an obvious main band detected by agarose gel electrophoresis and the 260nm / 280nm value of the trace spectrophotometric purity test is between 1.8-2.2, and is diluted to 40-60ng / μl for use;

[0140] The common restriction endonuclease is preferably a restriction endonuclease that recognizes a 4.5 base sequence and a restriction endonuclease that recognizes a 4 base sequence, more preferably AvaII and MspI;

[0141] The third step is to use T4 DNA ligase to connect the A1 adapter (...

Embodiment 2

[0188] The establishment of double enzyme digestion simplified genome next-generation sequencing library construction method:

[0189] This embodiment selects two kinds of bamboos of Gramineae Bambooideae, Phyllostachysviridi-glaucescens (Carr.) A.etC.Riv. and Pseudosasajaponica (Sieb.etZucc.) Makino) as Experimental materials, double enzyme digestion simplified genome next-generation sequencing library construction basic operation process, see figure 1 , including the following steps:

[0190] The first step, genomic DNA extraction

[0191] The whole genome DNA of the young leaves of P. viridi-glaucescens (Carr.) A. et C. Riv. and P. japonica (Sieb. et Zucc.) Makino) were extracted by the improved CTAB method, respectively. Proceed as follows:

[0192] (1) Take 10ml of 4% CTAB and preheat it at 60°C, add 2‰ dithiothreitol DTT and mix well.

[0193] (2) Weigh 60mg of fresh young leaves, add liquid nitrogen and quickly grind them into powder, transfer to a 2ml small centri...

Embodiment 3

[0263] Genome-wide interspecific variation SNP detection of 20 temperate woody bamboo species:

[0264] Use double-digestion simplified genome next-generation sequencing library construction kit for research. Double Digestion Simplified Genome Next Generation Sequencing Library Construction Kit contains:

[0265] 1) A1 linker sequence pairs consisting of 20 sequences, each sequence structure is:

[0266] Positive strand: 5'TACACGACGCTCTTCCGATCTXXXXX3',

[0267] Negative strand: 5'GWCYYYYYAGATCGGAAGAGCGTCGTGTA3'.

[0268] Wherein: XXXXX in the positive strand represents the DNA barcode sequence, YYYYY in the negative strand represents the sequence complementary to the DNA barcode, and W represents the base A or T. This kit only provides the A1 linker sequence pair corresponding to AvaII, and the A1 linker sequence pair corresponding to the rest of the enzymes can be directly synthesized from biological companies.

[0269] 2) A2 linker sequence, specifically:

[0270] Posit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a construction method for a simplified genome next generation sequencing library based on double enzyme digestion and a kit. Aiming at defects of an existing construction method for the double enzyme digestion simplified genome next generation sequencing library, the double enzyme digestion combined range is expanded, and excessive dependence on expensive instruments of constructing the simplified genome library is reduced, the library construction flow path is simplified, library construction cost is reduced, the sequencing efficiency is improved, and meanwhile the technology is easy and flexible to operate and easier for researchers to master and can be realized in a common molecule lab. The construction method is particularly suitable for miniature or medium-scale labs needing to conduct SNP molecular marker development, genetic map construction, population genetics research, phylogeny biological research and the like on a great number of species with incomplete reference genomes. The construction method has good practical application value and application prospects in the fields of molecular breeding of agriculture, conservation biology and evolutionary biology.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for constructing a simplified genome next-generation sequencing library based on double enzyme digestion and a matching kit for constructing the next-generation sequencing library. Background technique [0002] Restriction-site Associated DNA (RAD) sequencing technology, that is, RAD-seq technology is a simplified genome sequencing technology based on genome-wide restriction sites developed on the basis of next-generation sequencing (BairdN. J., et al, 2008). This technology uses a restriction endonuclease to single-enzyme digest the genome, combined with physical methods to break it up to generate DNA fragments of a certain size and construct a sequencing library, so that high-throughput sequences near the restriction site can be achieved sequencing. Since the RAD marker is a DNA fragment near the genome-wide specific restriction site, it can represent the seq...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C40B50/06C12Q1/68
Inventor 杨国骞郭岑陈云梅郭英王晓燕郭振华李德铢
Owner KUNMING INST OF BOTANY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More