Unlock instant, AI-driven research and patent intelligence for your innovation.

Expression vector and expression method of calf intestinal alkaline phosphatase

An expression vector and expression method technology are applied in the field of expression vector of calf intestinal alkaline phosphatase to achieve the effects of accurate expression and good sensitivity

Active Publication Date: 2016-07-27
ZHENGZHOU KODIA BIOTECHNOLOGY CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the process of prokaryotic expression, the selection of codons, the type of vector, and the expression conditions will have an important impact on the expression results, and there is no report on the prokaryotic expression method for CIAP.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression vector and expression method of calf intestinal alkaline phosphatase
  • Expression vector and expression method of calf intestinal alkaline phosphatase
  • Expression vector and expression method of calf intestinal alkaline phosphatase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] The construction of embodiment 1 expression vector

[0044] 1) Artificially synthesize the nucleotide sequence shown in SEQ ID NO: 2, and digest it with NdelI-HindIII enzyme, and the digestion condition is 37 degrees. The digested product was subjected to agarose gel electrophoresis, and a nucleotide fragment with a size of 1545 bp was recovered from the gel.

[0045] 2) The PMAL-c5x vector is digested with NdelI-HindIII enzyme, and the digestion condition is 37 degrees. The digested products were subjected to agarose gel electrophoresis, and fragments with a size of about 1500 bp were recovered from the gel.

[0046] 3) Ligate the digested linear vector and the target fragment with T4 DNA ligase at a ligation temperature of 16°C overnight.

[0047] 4) The ligation product was transformed into Escherichia coli DH5α, cultured in LB medium containing ampicillin antibiotic, and positive colonies were picked for colony PCR identification. Propagate the colonies with posi...

Embodiment 2

[0073] Embodiment 2 fusion protein expression

[0074] 1. The strains constructed in Example 1 and Comparative Examples 1 to 4 were induced to express the target protein, and detected, the method was as follows:

[0075] 1), Shake the strain in 3ml LB medium to OD 600 0.6, add IPTG, IPTG concentration is 0.3mmol / L, 37°C, 140rpm induction overnight;

[0076] 2) SDS-PAGE electrophoresis to detect the expression of the target protein of each strain, and to detect inclusion bodies.

[0077] The results show that: after the strains of Example 1 and Comparative Examples 1 to 2, the fusion protein was successfully expressed in the supernatant formed after the broken bacteria; while Comparative Example 3 and Comparative Example 4 also expressed the fusion protein, However, its protein formed inclusion bodies and did not appear in the supernatant.

[0078] 2, the bacterial classification of embodiment 1, comparative example 1~2 is carried out expansion culture, and detects, and meth...

Embodiment 3

[0088] Preparation and application of embodiment 3 probes

[0089] Taking the CIAP protein extracted and obtained in the prior art as a control, and taking the CIAP fusion protein expressed by the strain obtained in Example 1 as the experimental object, the two were respectively coupled with a probe whose sequence is AGGTCTCTGCTTAGAGGTACTT, and the probe is used for SAT Technical Report Detection Probes. For coupling methods, please refer to patents 6686461, 6800728, 7102024, 7173125, and 7462689 with product instructions attached.

[0090] Implementation process:

[0091] The application of probe labels in SAT technology;

[0092] Step 1 designs a nucleic acid sequence of a coating primer (5'-NH2-GAGCGGATATATGCTTAGGAAT-3'), synthesizes the sequence and dissolves it in a TE buffer solution with a pH of 8.0, and dilutes the primer to 3-5ug / ml;

[0093] Step 2 Prepare the coating buffer, according to the components in the formula table, sodium dihydrogen phosphate, disodium h...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of biology, in particular to an expression vector and an expression method of calf intestinal alkaline phosphatase (CIAP).By means of the expression method, CIAP protein can be efficiently and accurately expressed, and the biological activity of the CIAP protein is not affected.Experiments show that through 24 h culture, 30 mg of CIAP fusion protein can be generated by every OD600 cells.An SAT reporting probe prepared from the CIAP fusion protein provided with the method has good sensitivity, and compared with CIAP protein extracted in the prior art, the nature has no obvious difference.

Description

technical field [0001] The invention relates to the field of biological technology, in particular to an expression vector and an expression method of calf intestinal alkaline phosphatase. Background technique [0002] Calf intestinal alkaline phosphatase (CalfIntestinalAlkalinePhosphatase, referred to as CIAP), its amino acid sequence as shown in SEQIDNO: 1, through the chemical coupling agent S-HyNic (acyl succinimide ester acetone hydrazone), 4FB (succinimide 4 -formylbenzoic acid) cross-linking effect, the ε amino group on the amino acid side chain of calf intestinal alkaline phosphatase and the amino group at the 3' end of the oligonucleotide are replaced by nitrile and aldehyde groups respectively, thereby making the calf intestinal alkaline Phosphatase and oligonucleic acid are combined to react to form a complex secondary protein-nucleic acid structure, which is purified by FPLC (high performance liquid chromatography) or concentrated and purified by ultrafiltration a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/55C12N15/62C12N9/16C07K19/00C12Q1/42C12N15/70C12N1/21C12R1/19
Inventor 张鹭鹭李先坤何丽
Owner ZHENGZHOU KODIA BIOTECHNOLOGY CO LTD