Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of β-glucosidase gene and its application

A technology of glucosidase and gene, applied in the field of microorganisms

Active Publication Date: 2019-12-31
NANJING TECH UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

β-glucosidase generally decomposes cellobiose into glucose extracellularly through surface display and signal peptide expression, so as to supply cells for growth. At present, there is no β-glucosidase that does not require surface display or signal peptide expression growth on cellobiose

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of β-glucosidase gene and its application
  • A kind of β-glucosidase gene and its application
  • A kind of β-glucosidase gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1 obtains β-glucosidase gene

[0040] This example illustrates the method for obtaining the β-glucosidase gene of the present invention. Specific steps are as follows:

[0041] (1) Sample collection: Soil samples were collected near the small garden beside the east playground of Nanjing University of Technology.

[0042] (2) Extraction of total soil DNA: Weigh 1 g of soil sample, add 1 mL of 0.1mol / mL, pH 8.0 phosphate buffer and glass beads, shake for 1 min, add 5 mg of lysozyme to make the final concentration of lysozyme 2.5 mg / mL, Shake at room temperature for 15 minutes, place in refrigerator for 30 minutes, add 125 μL of 20% SDS for shaking treatment for 15 minutes, centrifuge, add phenol (1:1 volume) for extraction once, chloroform-isoamyl alcohol (1:1 volume) for extraction twice, add 0.6 volume of isopropanol, placed at room temperature for 1 hour, centrifuged, washed with 70% ethanol, and dissolved in 30 μL TE.

[0043] (3) Construction of a genom...

Embodiment 2

[0052] The amplification of embodiment 2β-glucosidase gene

[0053] This example illustrates the specific process of β-glucosidase gene amplification.

[0054] see figure 1 , using PCR to clone the β-glucosidase gene of the present invention. The designed primers are as follows:

[0055] Upstream primer P1: Tm=66.7, 45mer; the primer sequence is as follows:

[0056] CAAATGGGTCGCGGATCCGAATTCATGAAAGTAAAATCAACATGG;

[0057] Downstream primer P2: Tm=68.7, 52mer; primer sequence is as follows:

[0058] TTGTCGACGGAGCTCGAATTCTTACTTTTTTTGCCTTTTCTGTAGAGGTTGCC;

[0059] Use PCR to amplify the β-glucosidase gene. In a 50 μL reaction system, the amount of the two primers P1 and P2 added is 1 μL. The amplification conditions are: 94°C preheating for 10 minutes; 94°C for 45s; 55°C for 45s ; 72°C, 2.5min; 72°C, 10min, three steps in the middle, a total of 30 cycles, the DNA polymerase used is 2×Phanta @ Master Mix enzyme (Novazyme, China).

[0060] After the PCR was finished, the fra...

Embodiment 3

[0061] Embodiment 3β-glucosidase gene is expressed in escherichia coli

[0062] The above sequence of SEQ ID NO: 1 was directly connected to the prokaryotic expression vector pET-28a(+), and reacted at 37°C for 30 minutes. This vector was transformed into competent DH5α. A single colony was obtained by coating the bacterial solution on a solid LB medium (mass fraction formula: 2% peptone, 1% yeast powder, 1% NaCl, 1-2% agar) containing 30 μg / mL ampicillin. Pick a single colony and culture it overnight in a 5mL liquid LB test tube, extract the plasmid, and perform single and double enzyme digestion verification. Select and verify that the correct plasmid is transformed into Escherichia coli E.coli BL21(DE3). A single colony was obtained after the bacterial liquid was coated with solid LB medium containing 30 μg / mL ampicillin and cultivated. Then pick a single colony and culture it overnight in a 5mL liquid LB test tube, extract the plasmid, perform single and double enzyme d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a beta-glucose glycosides enzyme gene. The beta-glucose glycosides enzyme gene is obtained from soil total DNA, and the nucleotide sequence is SEQ ID NO: 1. According to the beta-glucose glycosides enzyme, a surface display or signal peptide expression technology is not needed, a thallus can directly utilize cellobiose, and thus production of succinic acid is conducted.

Description

technical field [0001] The invention relates to the technical field of microorganisms, in particular to a beta-glucosidase gene and its application. Background technique [0002] β-glucosidase (EC 3.2.1.21) belongs to hydrolases. It can hydrolyze and bind terminal, non-reducing β-D-glucose and corresponding ligands. This enzyme can hydrolyze cellobiose or short-chain glucans to glucose. Because it participates in the last step of cellulose hydrolysis, it is often considered to be the rate-limiting enzyme in the process of cellulose hydrolysis and saccharification. β-Glucosidase can be divided into two types according to the amino acid sequence: glycoside hydrolase family 1 and glycoside hydrolase family 3. Enzymes in glycoside hydrolase family 1 are mainly derived from bacteria, plants and mammals; enzymes in glycoside hydrolase family 3 are derived from fungi, bacteria and plants. It can be seen that its sources are relatively extensive. β-glucosidase generally decompo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/70C12N1/21C12P7/46C12R1/19
CPCC12N9/2445C12N15/70C12N2800/101C12P7/46C12Y302/01021
Inventor 姜岷薛梦蕾董维亮马江锋
Owner NANJING TECH UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com