New binary organic acid production strain, preparation and applications thereof

A binary organic acid and bacterial strain technology, applied in the field of biotechnology and bioengineering, can solve the problems of high cost, low fermentation temperature, and inability to obtain malic acid in production

Active Publication Date: 2016-11-23
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF5 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there are still many problems in malic acid fermentation. For example, the fermentation temperature required for malic acid is low, and the conventional fermentation process produces too much heat, so it needs to be cooled to continue t

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New binary organic acid production strain, preparation and applications thereof
  • New binary organic acid production strain, preparation and applications thereof
  • New binary organic acid production strain, preparation and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0158] Example 1. Overexpression of the C4-dicarboxylic acid transporter gene mae1 in Myceliophthora thermophila to obtain the ability to produce malic acid

[0159] 1. Construction of mae overexpression vector (pAN52-mae)

[0160] Taking pAN52-TB-Intron (Liu Q, Li J, Ying S, Wang J, Sun W, Tian C, Feng M. 2014. Unveiling equal importance of two 14-3-3proteins for morphogenesis, conidiation, stress tolerance and virus of An insect pathogen.EnvironMicrobiol.doi:10.1111 / 1462-2920.12634) was used as the backbone to construct an expression vector, and the plasmid pCSN44 (purchased from fungal genetics stock center) was used as a template to amplify the TrpC promoter under the regulation of the TrpC promoter under the guidance of primers. Mycin phosphotransferase coding gene (hph), the primer sequence is as follows:

[0161] hph-F: (SEQ ID NO.: 23)

[0162] GCTCTAGACAGAAGATGATATTGAAGGAGC

[0163] hph-R: (SEQ ID NO.: 24)

[0164] CCCAAGCTTTCTATTCCTTTGCCCTCGGACGAG

[0165] The h...

Embodiment 2

[0212]Example 2 Overexpressing genes encoding C4-dicarboxylic acid transporters from different sources in Myceliophthora thermophila to obtain recombinant microorganisms can significantly improve the production capacity of malic acid.

[0213] 1. Homology comparison analysis of C4-dicarboxylate transporter

[0214] This embodiment selects the C4-dicarboxylic acid transporter (AO090023000318, mae, SEQ ID NO.: 12) from Aspergillus oryzae NRRL3488 and the Neurospora crassa C4-dicarboxylic acid transporter (XP_958365, NCmae, SEQ ID NO.: 14 ), Trichoderma reesei C4-dicarboxylic acid transporter (XP_006963989, Trmae, SEQ ID NO.: 16), Myceliophthora thermophila C4-dicarboxylic acid transporter (XP_003663832, Mtmae, SEQ ID NO.: 18) , Aspergillus niger NRRL599C4-dicarboxylic acid transporter (XM_001398094, Anmae, SEQ ID NO.:20), Aspergillus sojae NBRC4239C4-dicarboxylic acid transporter (Asmae, SEQ ID NO.:22).

[0215] 2. Construction of C4-dicarboxylate transporter gene expression ve...

Embodiment 3

[0243] Example 3. Simultaneous overexpression of the C4-dicarboxylic acid transporter gene mae and pyruvate carboxylase pyc in Myceliophthora thermophila to enhance its ability to produce malic acid

[0244] 1. Construction of mae and pyc co-expression vector

[0245] Using the plasmid pAN52-TB-Intron as a template, under the guidance of primers, the promoter of Aspergillus nidulans gpdA was amplified by PCR. See Step 1 of Example 1 for the PCR conditions and system, named AngpdA (SEQ ID NO.:84 ). Primers are as follows

[0246] ANgpadA-F: ​​(SEQ ID NO.: 61)

[0247] CCTTAATTAAGTCCAGATCATGGTTGACCGGTG

[0248] ANgpdA-R: (SEQ ID NO.: 62)

[0249] GAACCTCCTTCAGAGAGGTTCGTGTTTAAACTGATGTCTGCTCAAGCGGGGTA

[0250] Then, using the primers and using the genome of the starting strain Myceliophthora thermophila as a template, PCR amplifies the terminator of the cellobiohydrolase coding gene cbh (MYCTH_109566) (SEQ ID NO.: 85). Primers are as follows:

[0251] CBH-F: (SEQ ID NO.: 63...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention provides a new binary organic acid production strain, preparation and applications thereof, particular a genetically modified engineering strain for binary organic acid synthesis. According to the present invention, an exogenous binary organic acid synthesis positive regulation gene is introduced into the engineering strain, and/or a binary organic acid synthesis negative regulation gene is down-regulated; compared to the starting strain, the binary organic acid production capacity of the engineering strain is significantly improved, wherein the binary organic acid comprises malic acid, succinic acid, fumaric acid, oxaloacetic acid, glutaric acid, and adipic acid; and the experiment results prove that the genetically modified engineering strain being subjected to the up-regulation of one or a plurality of the positive regulation genes and/or the down-regulation of one or a plurality of the positive regulation genes can resist the high temperature, effectively utilizes monosaccharides, polysaccharides, glycan or mixed saccharides, and particularly utilize the cheap carbon source (such as cellulose and the like) to synthesize the binary organic acid in the high-yield manner.

Description

technical field [0001] The invention relates to the fields of biotechnology and bioengineering. Specifically, the present invention relates to a novel engineering bacterium for producing binary organic acids and a method for preparing binary organic acids using the same. Background technique [0002] Given the rapid growth in demand for petroleum-based chemicals or fuels, and their increasing costs, as well as the impact of geopolitical instability on crude oil prices and the impact of greenhouse gas emissions on the global climate, there is an urgent need to develop a renewable, Sustainable green new processes to produce these petroleum-based chemicals or fuels. These factors have greatly promoted the research on the use of biomass from huge reserves to produce chemicals or fuels, especially the application of non-food renewable resources as raw materials (second-generation biorefinery). [0003] At present, the commonly used processes for biomass utilization are mostly d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/15C12N15/80C12N15/60C12N15/54C12N15/53C12N15/52C12N15/31C12P7/50C12P7/46C12P7/44C12R1/69C12R1/67C12R1/66C12R1/845C12R1/645
Inventor 田朝光李金根龙传南许晶林良才孙涛杨惠冀京枭刘倩马延和
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap