Biological activity small peptide preparation method based on combined self-cleavage and protein scaffold

A technology of biological activity and protein scaffold, which is applied in the field of bioactive small peptide preparation based on combined self-shearing and protein scaffold, can solve the problem of damage to myofibrils, save time, simplify steps and costs, and the steps are simple and convenient Effect

Active Publication Date: 2017-05-31
EAST CHINA UNIV OF SCI & TECH
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have found that deleting the C-terminus of Titin, including the kinase domain, can damage myofibrils, leading to muscle diseases such as muscle weakness

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biological activity small peptide preparation method based on combined self-cleavage and protein scaffold
  • Biological activity small peptide preparation method based on combined self-cleavage and protein scaffold
  • Biological activity small peptide preparation method based on combined self-cleavage and protein scaffold

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] The construction of embodiment 1.ELPs-mediated C-intein fusion LfcinB recombinant plasmid

[0082] Using the existing pET-22b-EI-mCherry plasmid in the laboratory, the original mCherry gene was excised by restriction endonuclease, and replaced with the lfcinb, 2lfcinb and 4lfcinb genes amplified by PCR or whole gene synthesis to construct pET- 22b-EI-LfcinB, ET-22b-EI-2LfcinB, pET-22b-EI-4LfcinB three recombinant expression plasmids. Nucleic acid electrophoresis verification and sequencing results showed that the recombinant plasmid was successfully constructed.

[0083] 3 LfcinB gene sequence: Since the length of LfcinB is only 75bp, 25 amino acid residues, its amino acid sequence is FKCRRWQW RMKKLGAPSITCVRRAF (SEQ ID NO: 1), so two longer primers can be directly designed, and the target gene can be obtained by overlapping PCR. The primers were designed as follows:

[0084] LfcinB-F:

[0085] CAGCGT GTACA CAACATGTTCAAATGCCGTCGTTGGCAGTGGCG BSrGI (SEQ ID NO: 2...

Embodiment 2

[0102] Expression and purification of embodiment 2.EI-LfcinB

[0103] Expression of EI-LfcinB: After exploring the expression conditions of the target protein, it was found that among the three recombinant proteins EI-LfcinB, EI-2LfcinB, and EI-4LfcinB, only EI-LfcinB was effectively expressed, while EI-2LfcinB, EI -4LfcinB cannot be expressed in two different expression hosts. Therefore, only the expression conditions of EI-LfcinB were explored, and the LfcinB antimicrobial peptide was successfully purified. The expression and purification results of EI-LfcinB are as follows: Figure 6 shown.

[0104] Depend on Figure 6 It can be seen that EI-LfcinB is expressed in E.coli BL21(DE3), and the fusion protein EI-LfcinB can be obtained through two ITC cycles, with a size of about 67KD. However, this method also has some shortcomings. It can be seen from the figure that there is still a small amount of foreign protein in the fusion protein purified by ITC.

[0105]Purificatio...

Embodiment 4

[0107] Example 4. Optimization and purification of EI-LfcinB induced expression conditions

[0108] In order to increase the yield of EI-LfcinB, we explored and optimized the expression conditions of pET-22b-EI-LfcinB / E.coli BL21(DE3), and the results are shown below.

[0109] (1) EI-LfcinB adding IPTG concentration optimization

[0110] Five experimental groups were designed, cultivated in a constant temperature shaker at 37°C, 200rpm for 2-3h, and waited for OD 600 After reaching about 0.5, add IPTG with final concentrations of 0.2, 0.4, 0.6, 0.8, and 1.0 mM to each group of test tubes, and turn to 20°C to induce expression for 24 hours. The bacteria were directly collected for SDS-PAGE, and the results Figure 8 It shows that when the induction concentration of IPTG is 1.0mM, the expression of EI-LfcinB is the highest.

[0111] (2) EI-LfcinB adding IPTG to induce expression temperature optimization

[0112] Five experimental groups were designed, cultivated in a constan...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a biological activity small peptide preparation method based on combined self-cleavage and a protein scaffold. The method includes the steps: (1) constructing ELPs (elastin-like polypeptides) mediated C-intein fusion LfcinB recombinant plasmids; (2) preparing Titin-LfcinB and Telethonin-LfcinB antibacterial fusion peptides by taking Escherichia coli as a host, and mixing the two antibacterial fusion peptides to prepare ZT-LfcinB. Expression, purification and stable utilization are coupled together, so that the whole small peptide is constructed into a drug with the stable scaffold by the aid of an expression vector and assembly in vitro in the whole process, and the practical problem of low expression production and utilization efficiency of some proteins and small peptides is effectively solved.

Description

technical field [0001] The invention belongs to the field of biomedicine and disease immunity, and more specifically relates to a method for preparing a bioactive small peptide based on combined self-cleavage and protein scaffolding. Background technique [0002] Since the discovery of penicillin in the 1940s, the widespread use of antibiotics has freed people from the fear of bacterial infection. However, with the long-term use and abuse of antibiotics, the emergence of drug resistance of pathogenic microorganisms has been stimulated. Drug-resistant Mycobacterium tuberculosis, MRSA, etc. are increasingly harmful to humans and animals, and have caused heavy economic losses to society. Progress in screening new antibiotics has also become increasingly difficult due to bacterial resistance. [0003] In the case of slow development of synthetic antibiotics, how to overcome the problem of bacterial resistance caused by antibiotics is a current research hotspot. Studies have f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C07K19/00A61K38/40A61P31/00A61P31/12
CPCA61K38/00C07K14/4707C07K14/4716C07K14/4728C07K14/79C07K2319/00C12N15/70C12N2800/101
Inventor马兴元李尚洁郑文云刘地陈潇潇李妍瑶
OwnerEAST CHINA UNIV OF SCI & TECH