Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

High-flux screening method for novel broad-spectrum lysozyme

A lysozyme and broad-spectrum technology, applied in the field of molecular biology, to achieve high-throughput detection and improve sensitivity

Active Publication Date: 2017-09-15
BEIJING TECHNOLOGY AND BUSINESS UNIVERSITY
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the existing screening methods, such as plate inhibition zone method, Oxford cup method, etc., cannot satisfy the above two requirements at the same time.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-flux screening method for novel broad-spectrum lysozyme
  • High-flux screening method for novel broad-spectrum lysozyme
  • High-flux screening method for novel broad-spectrum lysozyme

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1: Construction of tussah silkworm lysozyme gene mutation library

[0054] Tussah silkworm is an economic insect in northern China. Tussah silkworm lysozyme (Aplyz) has the characteristics of wide temperature range and low optimum temperature, and has good application value. The tussah silkworm lysozyme gene sequence was found from the NCBI database. The mature peptide sequence is 363bp in total. The company carried out the whole gene synthesis. The synthesized gene sequence is as follows:

[0055] AAGTGGTTTACCAAATGTGGTCTAGTGCACGAGCTGAGGAGACAAGGCTTCGACGAGAGCCTAATGAGAGACTGGGTCTGTTTGGTTGAGAACGAAAGCAGCAGATATACTAATAAAATCGGTAAAGTGAATAAGAATGGTTCTCAAGACTACGGTTTGTTCCAGATCAATGACAAATATTGGTGTAGTAAGACCTCCACCCCCGGAAAGGATTGCAATGTGACTTGTAATCAATTGTTGACTGACGATATTACAGTTGCTGCTACCTGTGCGAAGAAGATTTACAAGAGACATAAGTTTAACGCTTGGTACGGATGGTTAAACCACTGTCAACACTCTCTTCCAGACATTAGCGACTGTTAA;

[0056] According to the expression vector pPICZαA to be connected and the above-mentioned tussah silkworm...

Embodiment 2

[0082] Example 2: Transferring recombinant expression plasmids into Pichia pastoris cells

[0083] Pichia pastoris expression system is a good eukaryotic expression system, combined with pPICZαA expression plasmid can achieve good extracellular expression.

[0084] The specific operation steps for the preparation of Pichia pastoris competent cells are as follows:

[0085] (1) Pick a single clone of Pichia pastoris GS115 on the YPDS plate and inoculate it in 10 ml of YPD liquid medium. To ensure ventilation, seal it with 6 layers of gauze and culture overnight at 30°C and 250rpm.

[0086] (2) Transfer to a 250ml Erlenmeyer flask with baffles containing 50ml YPD liquid medium according to the inoculum size of 1%. 30°C, 250rpm shaking culture for about 20h to OD 600 It is 1.3-1.5.

[0087] (3) Transfer the bacterial solution into a pre-cooled 50ml centrifuge tube, place in an ice bath for at least 30 minutes to fully cool the cells, and collect the cells by centrifugation at 4...

Embodiment 3

[0100] Example 3: Construction of Escherichia coli expressing "cyan fluorescent protein-TEV protease recognition site-yellow fluorescent protein" in the cell

[0101] Escherichia coli is a typical Gram-negative bacterium, which is convenient to obtain, easy to operate and cultivate, and has a lipopolysaccharide outer membrane on the cell wall, so lysozyme has a poor cleavage effect on it.

[0102] According to the fluorescent protein gene and TEV protease recognition site gene sequences found in the NCBI database, the "cyan fluorescent protein-TEV protease recognition site-yellow fluorescent protein" gene was synthesized with XhoI and NocI restriction sites at both ends. sequence. The cloning plasmid and expression plasmid pET28a containing the protein pair gene were double-digested with two restriction endonucleases, and the desired fragment was recovered by electrophoresis. Prepare the connection system, connect the fluorescent protein pair gene and the expression plasmid p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of molecular biologics and discloses a high-flux screening method for a novel broad-spectrum lysozyme. The method comprises the following steps: A, performing secretory expression on a gene mutation library of a target lysozyme in eukaryotic cells so as to obtain fermentation liquids with different active target lysozymes; B, respectively adding the fermentation liquids with different active target lysozymes into a reaction system for reaction, and screening a lysozyme with high sterilization activity upon Gram negative bacteria, wherein the reaction system comprises Gram negative bacteria with intracellular expression of 'recognition site of donor fluorescin-protease-receptor fluorescin', protease and a protease reaction buffer solution. By adopting the method disclosed by the invention, through cascading of FRET (Fluorescence Resonance Energy Transfer) fluorescin pairs with locus specific protease, the detection sensitivity is remarkably improved; moreover, by adopting the method, high-flux detection on lysozymes can be achieved through a fluorescence microplate reader and a 96-microplate.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a high-throughput screening method for novel broad-spectrum lysozyme. Background technique [0002] Lysozyme (lysozyme, EC3.2.1.17), also known as muramidase, can specifically hydrolyze peptidoglycan, the main component in the cell wall of prokaryotic bacteria, decompose the cell wall of microorganisms, and make the bacteria lose the protection of the cell wall and regenerate in the cell wall. Under the action of internal high osmotic pressure, it ruptures and dies, so as to achieve the purpose of sterilization. In 1921, the famous British bacteriologist Alexander Fleming discovered lysozyme in human nasal fluid, and later confirmed that lysozyme widely exists in the egg whites of birds and birds, various organs and tissues and body fluids of mammals, plants, molluscs and inside the insect. [0003] As one of the most powerful antibacterial agents in highe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/40
CPCC12Q1/40G01N2333/936
Inventor 温赛刘怀然茅同心
Owner BEIJING TECHNOLOGY AND BUSINESS UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com