Multi-microbe solid fermentation ethanol and acetic acid production key microbe quantitative analysis method

A technology of solid-state fermentation and quantitative analysis, applied in the field of brewing, to achieve the effect of good specificity, high sensitivity and good repeatability

Active Publication Date: 2017-12-29
KWEICHOW MOUTAI COMPANY
View PDF6 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, so far, there have been no reports on the detection of Saccharomyces cerevisiae, S. pombe and lactic acid bacteria in fermented grains by using fluorescent quantitative PCR method in China.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multi-microbe solid fermentation ethanol and acetic acid production key microbe quantitative analysis method
  • Multi-microbe solid fermentation ethanol and acetic acid production key microbe quantitative analysis method
  • Multi-microbe solid fermentation ethanol and acetic acid production key microbe quantitative analysis method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1 Extraction of Microorganism Genome DNA from Fermented Grains

[0054] Weigh 7.5g of fermented grains sample in a 50ml centrifuge tube, add 20ml of nucleic acid extraction buffer (2% CTAB (w / v), 100mM Tris-HCl (pH 8.0), 20mM EDTA (pH8.0), 1.4M NaCl), 20g of sterile quartz sand, shake for 1min with a nucleic acid extractor, centrifuge at 10000rpm for 10min; add an equal volume of P:C:I (phenol: chloroform: isoamyl alcohol = 25:24:1) to the supernatant, and centrifuge at 11000rpm for 20min; Add 2 times the volume of silica gel membrane-binding solution (4M guanidine hydrochloride, 0.5M potassium acetate), filter through the adsorption column, and discard the filtrate; dry the adsorption column for 1 hour under natural conditions, add 300 μL sterile water to dissolve the DNA, filter, and fill the filtrate in 1.5 mL without Store in centrifuge tubes at -20°C for later use.

Embodiment 2

[0055] Example 2 standard curve construction

[0056] 1. Synthesis of specific primers for Saccharomyces cerevisiae HIS3, Saccharomyces pombe ADH1 and Lactobacillus 16SrRNA

[0057] Saccharomyces cerevisiae specific primer sequence (5'-3'):

[0058] SEQ ID NO.1

[0059] S. cere-F: GGGCTGGAAGATCGGTGACTAC

[0060] SEQ ID NO.2

[0061] S. cere-R: AGCGTGAGGACAGTTGGATTCG

[0062] Schizosaccharomyces pombe-specific primer sequence (5'-3'):

[0063] SEQ ID NO.3

[0064] S. pombe-F: CGAGACGAGACGAGACGAGATG

[0065] SEQ ID NO.4

[0066] S. pombe-R: CGACAAACGGCACACCAAACG

[0067] Lactic acid bacteria specific primer sequence (5'-3'):

[0068] SEQ ID NO.5

[0069] Lac.16s-F: AGAACACCAGTGGCGAAGG

[0070] SEQ ID NO.6

[0071] Lac.16s-R: CAGGCGGAGTGCTTAATGC

[0072] 2. Obtain specific amplification target fragment

[0073] Using the pure DNA of Saccharomyces cerevisiae and Schizosaccharomyces pombe and the total DNA of fermented grains as templates, S.cere-F / S.cere-R, S.pombe-F...

Embodiment 3

[0086] Example 3 Fluorescence quantitative PCR of Saccharomyces cerevisiae, Schizosaccharomyces pombe and lactic acid bacteria in the microbial community of fermented grains

[0087] Quantification of Saccharomyces cerevisiae, S. pombe and lactic acid bacteria in the fermented grain sample: use the total DNA of the fermented grains obtained in Example 1, and use the specific primers for Saccharomyces cerevisiae, S. pombe and lactic acid bacteria in Example 2. Fluorescent quantitative PCR analysis of wine fermented grains was carried out according to the fluorescent quantitative PCR reaction system and fluorescent quantitative PCR program in Example 2.

[0088] According to the fluorescent quantitative PCR of the Saccharomyces cerevisiae standard substance, the linear equation y=-3.4263x+36.338 (R 2 =0.9969) (such as image 3 shown) to calculate the copy number of Saccharomyces cerevisiae in the fermented grains sample, and the fluorescence quantitative PCR amplification curve...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of liquor production, particularly to a multi-microbe solid fermentation ethanol and acetic acid production key microbe quantitative analysis method. The method comprises performing quantitative PCR (polymerase chain reaction) analysis on HIS3 genes of saccharomyces cerevisiae, AHD1 genes of schizosaccharomyces pombe and 16S rRNA (ribonucleic acid) fragments of lactobacillus to analyze the change tendency of the saccharomyces cerevisiae, the schizosaccharomyces pombe and the lactobacillus in liquor yeasts and fermented grains and accordingly to predict the yield of ethanol. The multi-microbe solid fermentation ethanol and acetic acid production key microbe quantitative analysis method has the advantages of being high in detecting speed and sensitivity, good in accuracy and specificity and free from cultivation.

Description

technical field [0001] The invention belongs to the technical field of brewing, and in particular relates to a quantitative analysis method for key microorganisms producing ethanol and lactic acid in multi-micro solid-state fermentation in liquor production enterprises. Background technique [0002] Saccharomyces cerevisiae and Schizosaccharomycespombe are two main wine-producing yeasts in the production process of Maotai-flavored liquor, and lactic acid bacteria (including Lactococcus, Lactobacillus, Pentosacea and Weiss The genus) is a kind of main lactic acid-producing microorganisms in the production of Maotai-flavored liquor. in the wine grains. Therefore, the amount of Saccharomyces cerevisiae, S. pombe and lactic acid bacteria in the fermented grains plays an important role in the flavor formation and yield stability of Maotai-flavor liquor. [0003] At present, the detection method for the number of Saccharomyces cerevisiae, S. pombe and lactic acid bacteria in the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/865C12R1/645C12R1/225C12R1/01
CPCC12Q1/6851C12Q1/689C12Q1/6895C12Q2531/113C12Q2563/107
Inventor杨帆晏培汪地强方芳陈坚王莉
OwnerKWEICHOW MOUTAI COMPANY