Preparation method of abyss sea cucumber sourced superoxide dismutase Cu, ZnSOD and application thereof

A kind of superoxide, dismutase technology

Active Publication Date: 2018-04-24
INST OF DEEP SEA SCI & ENG CHINESE ACADEMY OF SCI
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In view of this, the present invention provides a superoxide dismutase derived from abyssal sea cucumbers for the current problems of poor stability of SOD, difficulty in maintaining activity, difficulty in obtaining high-quality SOD genes, complex and cumbersome protein refolding and recovery process, etc. Cu, Zn-SOD and its preparation method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of abyss sea cucumber sourced superoxide dismutase Cu, ZnSOD and application thereof
  • Preparation method of abyss sea cucumber sourced superoxide dismutase Cu, ZnSOD and application thereof
  • Preparation method of abyss sea cucumber sourced superoxide dismutase Cu, ZnSOD and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Obtaining of total RNA and cDNA of abyssal sea cucumber Paelopatides sp.:

[0032] The abyssal sea cucumber Paelopatides sp. was collected from the 6500m abyss of the Mariana Trench (latitude: 10°57.1693’N, longitude: 141°56.1719’E). After adding RNAlater to the sample for grinding, the sample was immediately stored in liquid nitrogen. After returning to the laboratory, take 50-100mg sample tissue, use RNase FREE experimental paper to blot the residual RNAlater, and put the tissue into a 2ml centrifuge tube. Add 1000ul QIAzol, and use Ruptor to stir for 20-40 seconds to fully break up the sample. Place the homogenate at room temperature for more than 10 min. The processed homogenate was subjected to total RNA extraction according to the relevant operations of the QIAGEN Total RNA Extraction Kit. The cDNA was synthesized by reverse transcription after detecting that the RNA was not degraded by electrophoresis. The reverse transcription from total RNA to cDNA...

Embodiment 2

[0034] Example 2 Obtaining and sequence analysis of Paelopatides sp. superoxide dismutase PaSOD gene:

[0035] Using the cDNA sequence obtained in Example 1 as a template, the PaSOD gene is amplified with primers F and R, wherein,

[0036] Primer F: CG GGATCCATGTCTGTCCACGCCGTTTGTGTATT, the nucleotide sequence of which is shown in SEQ ID NO.3;

[0037] Primer R:AA CTGCAG TATCTTTTTGATCCCAATTACA, the nucleotide sequence of which is shown in SEQ ID NO.4;

[0038] The underlined part GGATCC represents the restriction site of Bam H I, and CTGCAG represents the restriction site of Pst I.

[0039] The PCR reaction system is 50 μL, including 10 μL PrimeSTAR GXL Buffer, 4 μL dNTP, 1 μL each of F and R primers, 1 μL template cDNA, 2 μL GXL DNA Polymerase (TaKARa company), with H 2 O to bring the total volume to 50 μL. The PCR reaction conditions were: 98°C for 10s, 55°C for 15s, 68°C for 10s, 30 cycles, and stored at 4°C. PCR products were purified by tapping and pMD TM 18-T Ve...

Embodiment 3

[0041] Example 3 Soluble expression and protein purification of Paelopatides sp. superoxide dismutase PaSOD gene:

[0042] The correctly sequenced DH5α was expanded and cultivated, and the plasmid was extracted. PaSOD carried out Bam H I and Pst I double enzyme digestion reactions on the plasmid and the pCold II vector plasmid at the same time. The PaSOD target gene and the linear pCold II vector were recovered from the gel, and the two were ligated overnight with TAKARA T4 ligase (TAKARA company), and the ligated product was transformed into Escherichia coli DH5α competent cells, and a single colony was picked for PCR and then the target DNA fragment was selected. Positive clones were sequenced.

[0043] The correctly sequenced DH5α was expanded and cultured, the plasmid was extracted, and transformed into Escherichia coli Chaperone CompetentCell pG-KJE8 / BL21. After spreading the plate, a single colony was picked for PCR to verify the correctness of the transformation. Sele...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of abyss sea cucumber sourced superoxide dismutase Cu, ZnSOD and application thereof. The method includes: extracting total RNA of Paelopatides sp., reversely transcribing into cDNA through RT-PCR, acquiring a gene sequence PaSOD coding superoxide dismutase through PCR amplification, establishing prokaryotic expression recombinant plasmid in pCold II vector, and guiding into chaperone Competent Cell pG-KJE8 / BL21 for recombinant protein soluble expression. Recombinant protein prepared through the method overcomes the defects that raw material sourcesare difficult to obtain and protein renaturation recycling process is complex and troublesome, purified protein is high in purity and vitality, wide in temperature suiting range and capable of resisting digestion by high-concentration digestive enzyme, and a foundation is laid for widely applying the protein in the field of biology, food, medicine and cosmetology.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a preparation method and application of superoxide dismutase Cu, Zn SOD derived from abyssal sea cucumber. Background technique [0002] Superoxide dismutase (SOD), referred to as SOD, is a biological enzyme that widely exists in nature. It can be divided into copper-zinc SOD, manganese SOD, iron SOD and nickel SOD according to the types of metals contained. Most of the SOD sold in the market are extracted from blood, which belongs to copper-zinc SOD (Cu, Zn-SOD). The Cu,Zn-SOD molecule is composed of two subunits, each subunit contains a copper ion and a zinc ion, and the molecular weight is about 32000Da. SOD is a kind of biological enzyme, its chemical essence is protein, and its toxicity has been extensively studied at home and abroad. Experiments have shown that it has no toxic and side effects on the human body and is a pure natural biologically ac...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C12N15/53C12N15/70
CPCC12N9/0089C12N15/70C12Y115/01001
Inventor李亚男张海滨孔雪刘君刘合露
OwnerINST OF DEEP SEA SCI & ENG CHINESE ACADEMY OF SCI