Unlock instant, AI-driven research and patent intelligence for your innovation.

A kit for multiplex PCR products identified by mass spectrometry for typing Vibrio cholerae

A Vibrio cholerae, multiplex technology, applied in the field of rapid identification of Vibrio cholerae products, can solve the problems of no reported influenza virus specific targets, no reported programs, and difficulty in teaching and detecting influenza viruses.

Active Publication Date: 2021-04-27
BIOYONG TECH
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method only briefly summarizes various possible technologies, and it neither reports specific protocols nor specific targets of influenza virus, so it is difficult to teach researchers to detect influenza virus by MALDI-TOF mass spectrometry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kit for multiplex PCR products identified by mass spectrometry for typing Vibrio cholerae
  • A kit for multiplex PCR products identified by mass spectrometry for typing Vibrio cholerae
  • A kit for multiplex PCR products identified by mass spectrometry for typing Vibrio cholerae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0078] Example 1: Establishment of nucleic acid fingerprints of Vibrio cholerae.

[0079] 1. Sequence matching

[0080] After searching the NCBI database, the conserved sequence of Vibrio cholerae DNA was selected from the ctxA fragment, >KX584736.1Vibrio cholerae strain R-18588cholera toxin A-subunit, and its sequence is SEQID NO.7:

[0081] GATATTACAGTAACTTAGATATTGCTCCAGCAGCAGATGGTTATGGATTGGCAGGTTTCCCCTCCGGAGC ATAGAGCTTGGAGGGAAGAG CCGTGGATTCATCATGCACCGCCGGGTTGT GGGAATGCTCCAAGATCATC GATGAGTAATACTTGCGATGAAAAAACCCA;

[0082] ctxB fragment, >KX584736.1Vibrio cholerae strain R-18588cholera toxin B-subunit, its sequence is SEQ ID NO.8:

[0083] TCACAAAAAAA AGCGATTGAAAGGATGAAGG ATACCCTGAGGATTGCATATCTTACTGAAGCTAAAGTCGAAAAGTTATGTGTAT GGAATAATAAAACGCCTCATG CGATTGCCGCAAATTAGTATGGCAAATTAAGATAATAAAAAAGCCACCTCAGTGGGCTTTTTTGTG;

[0084] ompW fragment, >KJ722608.1Vibrio cholerae O1strain N16961OmpW(ompW)gene, complete cds, its sequence is SEQ ID NO.9:

[0085] TTC TACCTCTGGTGGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for identifying multiple PCR products of Vibrio cholerae typing, including specific primers for amplifying the ctxA fragment, ctxB fragment and ompW fragment of Vibrio cholerae, a special spotting substrate for mass spectrometry, and a special mass spectrometry Microarray chip, mass spectrometry internal standard, mass spectrometry external standard. The kit of the present invention compares the obtained nucleic acid fingerprint feature spectrum with the nucleic acid fingerprint spectrum of Vibrio cholerae in the library, thereby judging the species of the bacteria to be tested. Based on the mass spectrogram generated by the kit, the Vibrio cholerae in the sample to be tested can be classified and identified, and the results can be widely used in the typing and classification of Vibrio cholerae, as well as in the fields of environmental health and public safety quarantine.

Description

technical field [0001] The invention belongs to the field of molecular biology detection, and relates to a product for quickly identifying vibrio cholerae by using time-of-flight mass spectrometry technology. Background technique [0002] Cholera is a severe infectious disease caused by Vibrio cholerae with diarrhea as the main symptom, and is listed as a Class A infectious disease in my country. Vibrio cholerae enters the digestive tract and reaches the small intestine, absorbs on the surface of the intestinal mucosa and multiplies rapidly, and the cholera enterotoxin produced acts on the small intestinal mucosa, causing excessive secretion of small intestinal fluid. In severe cases, vomiting and diarrhea may occur, leading to dehydration, metabolic acidosis, circulatory failure, and even shock and death. In addition to the need to strengthen the detection of Vibrio cholerae clinically, it is also necessary to detect cholera in terms of food safety (such as meat processing...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/689C12Q1/686C12Q1/04C12N15/11C12R1/63
CPCC12Q1/686C12Q1/689C12Q2600/16C12Q2537/143C12Q2565/627Y02A50/30
Inventor 马庆伟钟逾刘昕超
Owner BIOYONG TECH