Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Canine parvovirus vaccine composition, preparation method and application thereof

A technology of canine parvovirus and vaccine composition, applied in botany equipment and methods, biochemical equipment and methods, applications, etc., can solve the problems of attenuated virus strain mutation, susceptible to maternal antibody, immune failure, etc., and achieve good Immunogenicity, reduction and prevention of associated disease effects

Pending Publication Date: 2018-07-13
FUDAN UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the traditional attenuated CPV vaccine has been very successful in reducing the number of disease outbreaks, the immune effect of the attenuated and inactivated vaccines currently used in clinical practice has declined. Limitations are also increasingly revealed, for example: ① easily affected by maternal antibodies, leading to immune failure; ② vaccines may not be completely killed or sufficiently weakened during the production process, thus endangering animal health: ③ weak strains may mutate , the phenomenon of virulence reversion

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Canine parvovirus vaccine composition, preparation method and application thereof
  • Canine parvovirus vaccine composition, preparation method and application thereof
  • Canine parvovirus vaccine composition, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1 Construction of Canine Parvovirus VP2 Protein Kluyveromyces marx Recombinant Expression Vector

[0061] The amino acid sequence encoding canine parvovirus capsid protein VP2 is shown in SEQ ID No.1. According to the codon preference of Kluyveromyces marxis, the codon optimization of the VP2 gene sequence was carried out without changing the amino acid sequence. The optimized sequence is shown in SEQ ID No.2. Insert the optimized VP2 gene sequence into Kluyveromyces marx expression vector pUKD-N125 to construct the recombinant expression vector-PUKD-N125 / VP2, the specific process is as follows:

[0062] with specific primers

[0063] VP2-N125-F (SEQ ID No. 3)

[0064] 5' TTTTTTTGTT AGATCCGCGGATGAGTGACGGCGCAGTTC 3'

[0065] VP2-N125-R (SEQ ID No. 4)

[0066] 5'AGCTTGCGGCCTTAACTAGTTTAGTACAACTTTTCTAGGTG 3'

[0067] The VP2 gene was amplified by PCR, and the amplified product was subjected to 1% agarose gel electrophoresis to recover a 1755kb fragment, such as...

Embodiment 2

[0068] Example 2 Construction of Kluyveromyces marx genetically engineered bacteria Fim-1-pUKD-N125 / VP2

[0069] The yeast expression host strain used in the present invention is Kluyveromyces marxense Fim-1ura3Δ, and the preparation method of this strain can be constructed by the method disclosed in Example 1 of the Chinese patent publication CN105112313A, the auxotrophic strain Fim-1ura3Δ. Porcine parvovirus VP2 protein Kluyveromyces marx genetic engineering strain Fim-1-pUKD-N125 / VP2 is obtained by transforming the recombinant expression vector pUKD-N125 / VP2 to construct the Fim-1ura3Δ strain, the implementation process is as follows: The yeast Fim-1ura3Δ was inoculated in a glass test tube containing 3 mL of YEPD medium, and cultured overnight on a shaker at 30°C until the OD600 was 12-15. The cells were collected and washed with LiAc-TE solution (100 mM LiAc, 10 mM Tris-HCl pH 7.5, 1 mM EDTA). Add carrier DNA, recombinant expression vector pUKD-N125 / VP2, PEG solution (40...

Embodiment 3

[0071] Example 3 Expression of Canine Parvovirus VP2 Protein in Kluyveromyces marx

[0072] Recombinant engineered bacteria Fim-1-pUKD-N125 / VP2 and control bacteria Fim-1ura3Δ were respectively inoculated in 50ml of YD medium (1% yeast extract, 2% glucose), cultured at 30°C, 220rpm for 66h and then centrifuged The cells were collected, resuspended with 10 mM Tris-HCl (pH 7.5), and then homogeneously disrupted by high pressure. Take 100 μl of cell lysate and add protein electrophoresis loading buffer to mix, boil water for 5 min, then perform protein electrophoresis SDS-PAGE (polyacrylamide gel electrophoresis, PAGE) and Western Blot with CPV-VP2 antibody to detect the expression level of VP2 protein. The CPV-VP2 antibody used for Western Blot detection is a polyantibody serum isolated from mice immunized with PPV-VP2 protein recombinantly expressed in Escherichia coli, and the secondary antibody is a goat anti-mouse polyclonal antibody labeled with horseradish peroxidase.

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Dry cell weightaaaaaaaaaa
Theoretical molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses canine parvovirus vaccine composition injection preparation and oral preparation. The canine parvovirus vaccine composition injection preparation and oral preparation contain the following (a) and (b), and basically comprise the following (a) and (b), or comprise the following (a) and (b): (a) virus-like particle formed by self-assembling canine parvovirus VP2 protein expressed kluyveromyces marxianus recombinant bacterium; (b) an auxiliary material which is acceptable in terms of medicine or veterinary medicine and used for an injection / oral preparation. The inventionfurther discloses a preparation method and application of the vaccine composition. The canine parvovirus virus particle vaccine can obtain high-level serum IgG antibody after immunization, has excellent immunogenicity, can reduce and prevent relevant diseases caused by canine parvovirus infection, has the advantages of high safety, low production cost, capability of enlarging scale production andhigh convenience in operation, and can be applied to the prevention and reducing of relevant clinical symptoms caused by CPV infection.

Description

technical field [0001] The invention relates to the fields of biotechnology and veterinary medicine, in particular to a canine parvovirus vaccine composition and a preparation method and application thereof. Background technique [0002] Canine parvovirus is an acute highly contagious disease that can cause hemorrhagic gastroenteritis in adults and myocarditis in puppies. The disease was discovered by Eugster in 1977. Canine parvovirus disease is caused by Canine Parvovirus (CPV), which mainly causes vomiting and bloody diarrhea in sick dogs, accompanied by a large number of leukopenia and other symptoms. The disease can occur all year round, and has the characteristics of acute onset, short course of disease, strong infectivity, and high mortality. Dogs of different breeds and ages are susceptible, and puppies are highly susceptible, with a morbidity rate of 50%-100% and a mortality rate of 10%-50%. The disease seriously affects the health of domestic pets, and at the sam...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/23A61P31/20A61P1/08A61P7/00A61P1/00A61P9/00C12N15/81C12N15/35
CPCA61K39/12A61K2039/53A61K2039/552C07K14/005C12N15/815C12N2750/14323C12N2750/14334
Inventor 吕红陈蕾周峻岗余垚
Owner FUDAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com