Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Recombinant escherichia coli expressing formamidase and phosphite dehydrogenase fusion protein, construction method and application thereof

A technology of phosphite dehydrogenase and recombinant Escherichia coli, which is applied in the field of genetic engineering and can solve problems such as common bacteria

Active Publication Date: 2018-07-24
SOUTH CHINA UNIV OF TECH
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the complex surrounding environment and the hidden parts of the fermentation equipment make it often contaminated with bacteria during the fermentation process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant escherichia coli expressing formamidase and phosphite dehydrogenase fusion protein, construction method and application thereof
  • Recombinant escherichia coli expressing formamidase and phosphite dehydrogenase fusion protein, construction method and application thereof
  • Recombinant escherichia coli expressing formamidase and phosphite dehydrogenase fusion protein, construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Acquisition of formamidase gene for (including Linker sequence)

[0052] Paenibacillus pasadenensis.CS0611 was cultured in LB medium at 37°C and 180rpm for one day; the cultured cells were collected at 4°C, 8000rpm and centrifuged for 5min, and washed twice with normal saline to remove residual culture The genome of Paenibacillus pasadenensis.CS0611 was extracted according to the specific method of the OMEGA bacterial genome DNA extraction kit;

[0053] Using the extracted Paenibacillus pasadenensis.CS0611 genome as a template, and A2(5'- CGACCCACCA CCGCCCGAGCCACCGCCACC TCGCGCCGCGCCTCCCTTCG C-3') are the upstream and downstream primers respectively, and the formamidase gene for-Linker is amplified by PCR;

[0054] The enzyme reagents used in PCR are TaKaRa company HS DNA Polymerase with GCbuffer; PCR reaction system and conditions are as follows:

[0055] Composition of PCR reaction solution (25μL)

[0056]

[0057] PCR reaction conditions: 94°C for 5 min...

Embodiment 2

[0060] The acquisition of phosphite dehydrogenase gene ptx

[0061] The phosphite dehydrogenase gene is derived from the self-screened Klebsiella pneumonia.OU7, obtained through self-screening;

[0062] The self-screened Klebsiella pneumonia.OU7 genome was extracted according to the specific method of the OMEGA bacterial genome DNA extraction kit, and the self-screened Klebsiella pneumonia. - TGGCTCGGGCGGTGGTGGGTCGATGCTGCCGAAACTCGTTATA-3') and The upstream and downstream primers are respectively used to amplify the phosphite dehydrogenase gene ptx by PCR;

[0063] The enzyme reagents used in PCR are TaKaRa company HS DNA Polymerase with GCbuffer; PCR reaction system and conditions are as follows:

[0064] Composition of PCR reaction solution (25μL)

[0065]

[0066]

[0067] PCR reaction conditions: 94 °C for 5 min; then 98 °C for 10 s, 55 °C for 5 s, 72 °C for 70 s, and cycle 30 times; then 72 °C for 7 min; and finally cooling to 16 °C.

[0068] The DNA product...

Embodiment 3

[0070] The fusion gene for-Linker-ptx was obtained by overlapping PCR amplification

[0071] Take the amplified for-Linker and ptx fragments as templates, and use primers and primers The upstream and downstream primers, respectively, were amplified to obtain the fusion gene for-Linker-ptx.

[0072] The amplification conditions were as follows: 94°C for 5 min; then 98°C for 10 s, 55°C for 5 s, 72°C for 150 s, and cycled 30 times; finally, 72°C for 7 min; and finally cooling to 16°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses escherichia coli expressing formamidase and phosphite dehydrogenase fusion protein, a construction method and application thereof. The method comprises the following steps: taking escherichia coli DH5 alpha engineering bacteria as a host, amplifying formamidase gene and phosphite dehydrogenase gene formed through cloning into fusion gene, then connecting the fusion gene toa multiple cloning site, transferring obtained recombinant plasmid into DH5 alpha, extracting plasmid and transferring the plasmid into an expression strain, and performing induction culture, so as toobtain the recombinant escherichia coli. The recombinant escherichia coli produces the formamidase and phosphite dehydrogenase fusion protein through expression, the fusion protein can decompose formamide to produce NH4<+> and oxidize phosphite to produce phosphate at the same time, and provides a nitrogen source and a phosphorus source required for growth and reproduction of recombinant escherichia coli engineering bacteria, while other microorganisms cannot grow and reproduce in an MOPS culture medium containing formamide and phosphite because the microorganisms do not have two paths, and the problem of contamination of escherichia coli during industrial fermentation is solved.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a recombinant Escherichia coli expressing a fusion protein of formamidase and phosphite dehydrogenase, and a construction method and application thereof. Background technique [0002] E. coli is currently one of the most widely used hosts because of its well-studied genome, fast reproduction and short fermentation cycle. Therefore, Escherichia coli is closely followed and valued by entrepreneurs in the industrial fermentation industry. However, in the process of E. coli fermentation, the problem of bacterial contamination is still the most concerned problem for enterprises. Once infected, it will not only cause economic losses, waste of principle and time, but also increase the difficulty of waste disposal. Therefore, if we can find a way to solve the problem of Escherichia coli being contaminated by miscellaneous bacteria during the fermentation process, it will be very mean...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/70C12N15/62C12N15/66C12N9/80C12N9/02C12R1/19
CPCC12N9/0004C12N9/80C12N15/66C12N15/70C12Y120/01001C12Y305/01049C12Q1/686
Inventor 娄文勇区晓阳宗敏华高嘉心彭飞徐培
Owner SOUTH CHINA UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com