Unlock instant, AI-driven research and patent intelligence for your innovation.
Recombinant escherichia coli expressing formamidase and phosphite dehydrogenase fusion protein, construction method and application thereof
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology of phosphite dehydrogenase and recombinant Escherichia coli, which is applied in the field of genetic engineering and can solve problems such as common bacteria
Active Publication Date: 2018-07-24
SOUTH CHINA UNIV OF TECH
View PDF1 Cites 8 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
However, the complex surrounding environment and the hidden parts of the fermentation equipment make it often contaminated with bacteria during the fermentation process
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0051] Acquisition of formamidase gene for (including Linker sequence)
[0052] Paenibacillus pasadenensis.CS0611 was cultured in LB medium at 37°C and 180rpm for one day; the cultured cells were collected at 4°C, 8000rpm and centrifuged for 5min, and washed twice with normal saline to remove residual culture The genome of Paenibacillus pasadenensis.CS0611 was extracted according to the specific method of the OMEGA bacterial genomeDNA extraction kit;
[0053] Using the extracted Paenibacillus pasadenensis.CS0611 genome as a template, and A2(5'- CGACCCACCA CCGCCCGAGCCACCGCCACC TCGCGCCGCGCCTCCCTTCG C-3') are the upstream and downstream primers respectively, and the formamidase gene for-Linker is amplified by PCR;
[0054] The enzyme reagents used in PCR are TaKaRa company HS DNAPolymerase with GCbuffer; PCR reaction system and conditions are as follows:
[0055] Composition of PCR reaction solution (25μL)
[0060] The acquisition of phosphite dehydrogenase gene ptx
[0061] The phosphite dehydrogenase gene is derived from the self-screened Klebsiella pneumonia.OU7, obtained through self-screening;
[0062] The self-screened Klebsiella pneumonia.OU7 genome was extracted according to the specific method of the OMEGA bacterial genome DNA extraction kit, and the self-screened Klebsiella pneumonia. - TGGCTCGGGCGGTGGTGGGTCGATGCTGCCGAAACTCGTTATA-3') and The upstream and downstream primers are respectively used to amplify the phosphite dehydrogenase gene ptx by PCR;
[0063] The enzyme reagents used in PCR are TaKaRa company HS DNA Polymerase with GCbuffer; PCR reaction system and conditions are as follows:
[0064] Composition of PCR reaction solution (25μL)
[0065]
[0066]
[0067] PCR reaction conditions: 94 °C for 5 min; then 98 °C for 10 s, 55 °C for 5 s, 72 °C for 70 s, and cycle 30 times; then 72 °C for 7 min; and finally cooling to 16 °C.
[0068] The DNA product...
Embodiment 3
[0070] The fusion gene for-Linker-ptx was obtained by overlapping PCR amplification
[0071] Take the amplified for-Linker and ptx fragments as templates, and use primers and primers The upstream and downstream primers, respectively, were amplified to obtain the fusion gene for-Linker-ptx.
[0072] The amplification conditions were as follows: 94°C for 5 min; then 98°C for 10 s, 55°C for 5 s, 72°C for 150 s, and cycled 30 times; finally, 72°C for 7 min; and finally cooling to 16°C.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
technical field [0001] The invention relates to the field of genetic engineering, in particular to a recombinant Escherichia coli expressing a fusion protein of formamidase and phosphite dehydrogenase, and a construction method and application thereof. Background technique [0002] E. coli is currently one of the most widely used hosts because of its well-studied genome, fast reproduction and short fermentation cycle. Therefore, Escherichia coli is closely followed and valued by entrepreneurs in the industrial fermentation industry. However, in the process of E. coli fermentation, the problem of bacterial contamination is still the most concerned problem for enterprises. Once infected, it will not only cause economic losses, waste of principle and time, but also increase the difficulty of waste disposal. Therefore, if we can find a way to solve the problem of Escherichia coli being contaminated by miscellaneous bacteria during the fermentation process, it will be very mean...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More