Supercharge Your Innovation With Domain-Expert AI Agents!

Identification and application of IAA in secondary metabolite of streptomyces roseoflavus strain NKZ-259

A technology of NKZ-259, Streptomyces flavus, applied in the determination/inspection of microorganisms, microorganism-based methods, microorganisms, etc., can solve the problems of non-compliance with mass production, time-consuming consumables, etc.

Pending Publication Date: 2018-09-04
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Moreover, in these strains capable of producing IAA, many other secondary metabolites, such as various antibiotics, etc. will be produced during the metabolic process of each bacteria. They are completely mixed together. If you want to separate them separately, you need According to the physical and chemical properties of IAA, various separation columns, such as silica gel column, gel column, macroporous resin column, etc., can be separated to obtain some IAA, but this process is time-consuming and consumable, and does not meet the requirements of mass production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Identification and application of IAA in secondary metabolite of streptomyces roseoflavus strain NKZ-259
  • Identification and application of IAA in secondary metabolite of streptomyces roseoflavus strain NKZ-259
  • Identification and application of IAA in secondary metabolite of streptomyces roseoflavus strain NKZ-259

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1 Streptomyces roseoflavum NKZ-259 produces the gene prediction of IAA

[0046] Inoculate about 1 cm2 of bacteria block from Streptomyces roseoflavum NKZ-259 strain cultured on MS solid medium for 7 days and inoculate in liquid medium YEME, culture at 28°C and 200 rpm for 2 days, and use GENMED Streptomyces bacteria genomic DNA to purify The kit extracts the genomic DNA of the strain.

[0047] The key gene iaaM (Genbank accession No.: NP-625735) of the model bacteria Streptomyces coelicolor A3(2) IAA biosynthesis was found from Genbank, and primers were designed according to the iaaM gene:

[0048] iaaM-3F (5'-3'): GCCGATCACCATGTTCGGGC (SEQ ID NO: 1)

[0049] iaaM-3R (5'-3'): CTAGTCCTCGGGGAGTTCCA (SEQ ID NO: 2)

[0050] Using Streptomyces roseoflavum NKZ-259 (preservation number is CGMCC No.13416) DNA as a template to amplify the full length of the iaaM gene, the amplified gene sequence is shown in sequence 3, such as figure 1 shown. The amplified gene was ...

Embodiment 2

[0051] Detection of IAA in embodiment 2 Streptomyces roseus flavum NKZ-259

[0052] (1) TLC method to detect the presence of IAA in the secondary metabolites of Streptomyces roseoflavus NKZ-259

[0053] TSB fermentation medium: tryptone 15g, soybean peptone 5g, sodium chloride 5g, L-tryptophan 5.0g, water 1L, adjust pH to 7.2±0.2

[0054] (1) Streptomyces roseoflavum NKZ-259 was spread and inoculated onto MS medium with a sterile toothpick, and cultured at 28° C. in the dark for 7 days;

[0055] (2) Use a scalpel to inoculate a 1cm2 bacterial block into the fermentation medium, and ferment with shaking for 6 days (28°C, 200rpm);

[0056] (3) After filtering the obtained fermentation broth with filter paper, adjust the pH to 2 with 5N HCL, extract twice with ethyl acetate: fermentation broth = 1:1, combine the ethyl acetate phases, and steam at 40°C in a rotary evaporator. Dry and dissolve with a small amount of methanol.

[0057] (4) The sample dissolved in methanol is sepa...

Embodiment 3

[0064] IAA bioactivity detection in embodiment 3 Streptomyces roseus flavum NKZ-259

[0065] Pepper Growth Promoting Test

[0066] (1) The test was planted in plug trays. The matrix was configured with nutrient soil and vermiculite at a ratio of 3:1, placed in the plug trays, and the nutrient soil was poured thoroughly. Then 2-3 pepper seeds were sprinkled in each hole, and then a small amount of Cover the seeds with nutrient soil, spray an appropriate amount of water, and cover with plastic wrap.

[0067] (2) Remove the plastic wrap when the pepper seedlings emerge from the soil and grow 2 cotyledons. The test was divided into three groups. The test group was irrigated with 50-fold and 100-fold diluted NKZ-259 fermentation broth, and the control group was irrigated with clear water. Each treatment had 20 seedlings, and three repetitions were set. Cultivate in a greenhouse at 25°C and a relative humidity of 60%.

[0068] (3) When the pepper seedlings grew 2 true leaves, the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for identifying existence of IAA in a secondary metabolite of streptomyces roseoflavus strain NKZ-259. The method comprises the following steps: step 1, designing a primer according to a gene iaaM (Genbank accession No.: NP-625735); step 2, carrying out gene amplification by using the DNA of streptomyces roseoflavus strain NKZ-259 as a template, and comparing the gene obtained by amplification with the iaaM gene; and step 3, when the similarity between the amplified gene and iaaM gene in the second step is more than 80%, detecting the existence of IAA in the secondary metabolite of an NKZ-259 strain by using a TLC method or an HPLC method. The method provided by the invention has the beneficial effects that an analytical chromatograph is used to explore andobtain appropriate liquid phase conditions, a preparative chromatograph is used for separation and collection, and a pure IAA product is obtained by rapid separation. A fermentation broth is obtainedby mass fermentation in a fermentation tank and is collected directly by a preparative chromatography, which is convenient and quick.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the field of microbial secondary metabolites, and in particular to the identification and application of a secondary metabolite IAA of Streptomyces roseoflavus strain NKZ-259. Background technique [0002] Streptomyces roseus flavum belongs to aerobic, Gram-positive actinomycetes, and is an excellent biocontrol strain. It has a strong secondary metabolite capacity and can produce a large amount of secondary metabolites during its growth. Mainly include nucleosides, polyketones, indoles, terpenes, lactones, phenols, etc. Among these metabolites, there are not only substances with antibacterial activity such as antibiotics, but also substances that can promote plant growth. At present, it has been reported that other Streptomyces roseoflavus can produce various antibiotics such as aminoglycosides, macrolides and polyenes, but there are few reports that they can produce substances tha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P17/10C12Q1/689C05F11/08C12R1/465
CPCC12P17/10C05F11/08C12Q1/689
Inventor 葛蓓孛施李鸣张克诚麻金金刘炳花赵文珺崔海兰徐军
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More