A kind of Artemisia annua bzip transcription factor aaabf3 and its application
A technology of transcription factor and Artemisia annua, applied in the field of genetic engineering, can solve the problem of less research on the regulation mechanism of secondary metabolism
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Embodiment 1, the cloning of Artemisia annua AaABF3 gene
[0044] 1. Extraction of Total RNA from Artemisia annua Genome
[0045] Take the leaf tissue of Artemisia annua, grind it in liquid nitrogen, add it to a 1.5mL Eppendorf centrifuge tube filled with lysate, shake it fully, and extract total RNA according to the instructions of the TIANGEN kit. The quality of total RNA was identified by agarose gel electrophoresis, and then the RNA content was determined on a spectrophotometer.
[0046] 2. Cloning of the AaABF3 gene of Artemisia annua
[0047] Using the extracted total RNA as a template, cDNA was synthesized under the action of PowerScript reverse transcriptase; gene-specific primers were designed according to the sequence of the AaABF3 gene, as shown in Table 1, the AaABF3 gene was amplified from the total cDNA by PCR, and sequencing.
[0048] Through the above steps, the full-length coding sequence (SEQ ID NO: 1) of the transcription factor in Artemisia annua ...
Embodiment 2
[0053] Embodiment 2, the construction of the yeast single hybrid vector containing AaABF3 gene
[0054] The AaABF3 gene was constructed on the yeast single hybrid vector. In order to facilitate the construction of the expression vector, the restriction site of EcoRI was introduced into the forward primer, and the restriction site of XhoI was introduced into the reverse primer. The primers are shown in Table 3 ;
[0055] Table 3 PCR primers constructed by pB42AD-AaABF3 vector
[0056] Primer name Primer sequence (5'→3') EcoRI-AaABF3-FP CGGAATTCATGAGTTCATTAATGAATCCCAAG AaABF3-XhoI-RP GCCTCGAGCTACCAAGGTCCTGATAACGTTCTT
Embodiment 3
[0057] Yeast one-hybrid of embodiment 3, AaABF3 and ALDH1 promoter
[0058] 1. Yeast Competent Cell Preparation
[0059] The EGY48 strain was taken out from the -80°C refrigerator and streaked on the YPDA medium, cultured in a 30°C constant temperature incubator for three days, and the single clone that grew faster was picked and cultured overnight on 10 mL of YPDA (30, 220rpm), and the next day After the measured OD600 is greater than 2.0, dilute the bacterial solution with YPDA medium until the OD600 is 0.4, continue to shake the bacteria at 30°C for 2-4 hours, centrifuge at 2500rpm at room temperature for 10 minutes, discard the supernatant, then suspend with 40mL 1×TE, and then Centrifuge at room temperature at 2500rpm for 10min, carefully discard the supernatant, suspend in 2mL 1×LiAC / 0.5×TE, and place at room temperature for 10min, then the yeast is competent.
[0060] 2. Yeast Transformation
[0061] Add 2 μL each of the plasmid containing the AaABF3 gene and the plas...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


