Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of Artemisia annua bzip transcription factor aaabf3 and its application

A technology of transcription factor and Artemisia annua, applied in the field of genetic engineering, can solve the problem of less research on the regulation mechanism of secondary metabolism

Active Publication Date: 2021-03-30
SHANGHAI JIAOTONG UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the research on the regulation of plant stress response by ABA has been relatively sufficient, but there are few studies on the regulation mechanism of secondary metabolism.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of Artemisia annua bzip transcription factor aaabf3 and its application
  • A kind of Artemisia annua bzip transcription factor aaabf3 and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1, the cloning of Artemisia annua AaABF3 gene

[0044] 1. Extraction of Total RNA from Artemisia annua Genome

[0045] Take the leaf tissue of Artemisia annua, grind it in liquid nitrogen, add it to a 1.5mL Eppendorf centrifuge tube filled with lysate, shake it fully, and extract total RNA according to the instructions of the TIANGEN kit. The quality of total RNA was identified by agarose gel electrophoresis, and then the RNA content was determined on a spectrophotometer.

[0046] 2. Cloning of the AaABF3 gene of Artemisia annua

[0047] Using the extracted total RNA as a template, cDNA was synthesized under the action of PowerScript reverse transcriptase; gene-specific primers were designed according to the sequence of the AaABF3 gene, as shown in Table 1, the AaABF3 gene was amplified from the total cDNA by PCR, and sequencing.

[0048] Through the above steps, the full-length coding sequence (SEQ ID NO: 1) of the transcription factor in Artemisia annua ...

Embodiment 2

[0053] Embodiment 2, the construction of the yeast single hybrid vector containing AaABF3 gene

[0054] The AaABF3 gene was constructed on the yeast single hybrid vector. In order to facilitate the construction of the expression vector, the restriction site of EcoRI was introduced into the forward primer, and the restriction site of XhoI was introduced into the reverse primer. The primers are shown in Table 3 ;

[0055] Table 3 PCR primers constructed by pB42AD-AaABF3 vector

[0056] Primer name Primer sequence (5'→3') EcoRI-AaABF3-FP CGGAATTCATGAGTTCATTAATGAATCCCAAG AaABF3-XhoI-RP GCCTCGAGCTACCAAGGTCCTGATAACGTTCTT

Embodiment 3

[0057] Yeast one-hybrid of embodiment 3, AaABF3 and ALDH1 promoter

[0058] 1. Yeast Competent Cell Preparation

[0059] The EGY48 strain was taken out from the -80°C refrigerator and streaked on the YPDA medium, cultured in a 30°C constant temperature incubator for three days, and the single clone that grew faster was picked and cultured overnight on 10 mL of YPDA (30, 220rpm), and the next day After the measured OD600 is greater than 2.0, dilute the bacterial solution with YPDA medium until the OD600 is 0.4, continue to shake the bacteria at 30°C for 2-4 hours, centrifuge at 2500rpm at room temperature for 10 minutes, discard the supernatant, then suspend with 40mL 1×TE, and then Centrifuge at room temperature at 2500rpm for 10min, carefully discard the supernatant, suspend in 2mL 1×LiAC / 0.5×TE, and place at room temperature for 10min, then the yeast is competent.

[0060] 2. Yeast Transformation

[0061] Add 2 μL each of the plasmid containing the AaABF3 gene and the plas...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an Artemisia apiacea bZIP transcription factor which is marked as AaABF3. The nucleotide sequence of the Artemisia apiacea bZIP transcription factor is as shown in SEQ ID No. 1, and the amino acid sequence of the Artemisia apiacea bZIP transcription factor is as shown in SEQ ID No.2. The Artemisia apiacea bZIP transcription factor AaABF3 has the advantages that the Artemisia apiacea bZIP transcription factor AaABF3 combines with the promoter fragment of artemisinin synthesis key enzyme gene ALDH1 and activates the expression of the ALDH1 to promote the synthesis of artemisinin; by the aid of the transgenic technology, an Artemisia apiacea AaABF3 gene overexpression vector is used to convert Artemisia apiacea so as to evidently increase the artemisinin content of transgenic Artemisia apiacea; by the aid of the transgenic technology, an Artemisia apiacea AaABF3 gene interference vector is used to convert Artemisia apiacea so as to evidently lower the artemisinin content of transgenic Artemisia apiacea. The AaABF3 gene is applicable to Artemisia apiacea quality improvement, capable of increasing artemisinin content in the Artemisia apiacea and significant to the providing of a high-yield and stable medicinal herb resource for the large-scale production of artemisinin.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to an Artemisia annua bZIP-like transcription factor AaABF3 and its application. Background technique [0002] Artemisia annua (Artemisia annua L.) is a traditional medicinal plant originating in China. Artemisinin is a sesquiterpene compound present in Artemisia annua. Artemisinin-based artemisinin combination therapy (ACTs ) is recognized by WHO as the most effective antimalarial therapy. Currently, Artemisia annua is the only commercial source of artemisinin. In recent years, artemisinin and its derivatives have been found to have anti-schistosome, anti-virus, anti-tumor and therapeutic effects on diabetes. Therefore, artemisinin has broad application prospects at present and in the future. However, a key factor limiting the supply of artemisinin is that the content of artemisinin in common wild Artemisia annua plants is very low, accounting for only 0....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/82A01H5/00A01H6/14
CPCC07K14/415C12N15/8205C12N15/8243
Inventor 唐克轩钟旖珺黎凌郝小龙付雪晴马亚男谢利辉沈乾石璞孙小芬
Owner SHANGHAI JIAOTONG UNIV