Recombinant human TSG-6 protein, preparation method thereof and application of recombinant human TSG-6 protein in treatment of acute inflammatory diseases

A technology of TSG-6 and protein, applied in the biological field, can solve the problems of severe degree and harmfulness to the body, and achieve good therapeutic effect

Inactive Publication Date: 2018-09-14
ANHUI MEDICAL UNIV
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, if the inflammatory response lasts for a long time and is severe, it will be harmful to the body.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant human TSG-6 protein, preparation method thereof and application of recombinant human TSG-6 protein in treatment of acute inflammatory diseases
  • Recombinant human TSG-6 protein, preparation method thereof and application of recombinant human TSG-6 protein in treatment of acute inflammatory diseases
  • Recombinant human TSG-6 protein, preparation method thereof and application of recombinant human TSG-6 protein in treatment of acute inflammatory diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1 TSG-6 gene cloning, expression

[0033] 1. Inoculate human embryonic lung fibroblasts (MRC-5 cells) in a 10cm cell culture dish, inoculate human cytomegalovirus (HCMV) with Moi=1, and extract total RNA on the third day after inoculating the virus;

[0034] 2. Use 500ng RNA as a template to synthesize cDNA by reverse transcription, and use self-designed specific primers to PCR amplify the full-length coding sequence of TSG-6. The specific primer sequences used are as follows:

[0035] Upstream primer: CATATGATCATCTTAATTTACTTATTTCTCTTGCTATGG

[0036] Downstream primer: CTCGAGTAAGTGGCTAAATCTTCCAGCT

[0037] 3. Connect the amplified TSG-6 coding gene to the prokaryotic expression vector pET30a to construct the recombinant expression vector pET30a-TSG-6. After sequencing and identification, transform Escherichia coli BL21(DE3) to obtain the recombinant expression strain pET30a-TSG-6- BL21;

[0038] 4. The overnight cultured recombinant bacteria were inoculate...

Embodiment 2

[0042] Purification of embodiment two recombinant proteins

[0043] 1. Centrifuge the enlarged cultured TSG-6 recombinant expression bacteria at 12000r / min for 10min, collect the bacteria, resuspend in PBS solution, and sonicate;

[0044] 2. Centrifuge the completely broken bacterial liquid at 12000r / min for 15min to collect the precipitate;

[0045] 3. Washing: Wash the inclusion body twice with Buffer A (50mM Tris, 100mM NaCl, 2mM urea, 0.1% EDTA, pH8.0), 3h each time; centrifuge at 12000r / min for 15min;

[0046] Denaturation: The precipitate after centrifugation was dissolved in Buffer B (50mM Tris, 100mMNaCl, 8M urea, 1% β-mercaptoethanol, pH8.0) at a ratio of 1g:20mL. After it was completely dissolved, centrifuge at 12000r / min for 15min. Discard the precipitate to obtain protein denaturation solution;

[0047]Renaturation: Dilute the resulting denaturing solution with Buffer C (50mM Tris, 100mM NaCl, 1% β-mercaptoethanol, pH8.0) to a volume ratio of 1:2, and then dilute...

Embodiment 3

[0051] Example 3 TSG-6 recombinant protein is used to treat acute pneumonia in mice caused by HCMV infection

[0052] 1. Proliferation of HCMV

[0053] Human embryonic lung fibroblast MRC-5 1×10 5 / mL inoculated in 10cm cell culture dishes, 10mL per dish. After the cells adhered to the wall, HCMV virus was inoculated according to Moi=0.02. After incubation at 37°C for 2 h, the MEM medium containing 10% fetal bovine serum was replaced. On the third day after the virus inoculation, the MEM medium containing 3% fetal bovine serum was replaced and the culture was continued for 5-7 days. The virus-containing supernatant was harvested when the cytopathic effect of the virus reached "++++". After centrifugation at 2000r / min for 20min, the virus-containing supernatant was collected, and the number of infectious virus particles was determined by plaque formation assay.

[0054] 2. Establishment of acute pneumonia model in mice infected with HCMV

[0055] BALB / c mice of 6 to 8 wee...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant human TSG-6 protein, a preparation method thereof and application of the recombinant human TSG-6 protein in the treatment of acute inflammatory diseases. The aminoacid sequence of the recombinant human TSG-6 protein is as shown in SEQ ID No. 1, and the encoding gene nucleotide sequence of the recombinant human TSG-6 protein is as shown in SEQ ID No. 2. The recombinant human TSG-6 protein and the preparation method and application thereof have the advantages that a prokaryotic expression vector pET30a is utilized to build an Escherichia coli BL21(DE3) host strain capable of expressing the recombinant human TSG-6 protein, the strain is subjected to multiplication culture, isopropyl-beta-D-isopropylthiogalactoside induced expression and centrifuging are performed to obtain a thallus, the thallus is split and then inclusion body precipitate is collected centrifugally, and denaturation, renaturation and molecular-sieve purification are performed to obtain the recombinant human TSG-6 protein; the recombinant human TSG-6 protein has a good curative effect on the acute pneumonia, caused by HCMV virus infection, of mice and provides a new thought for thetreatment of the acute inflammatory diseases caused by virus infection.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a recombinant human TSG-6 protein, a preparation method and its application, in particular to the preparation of the recombinant human TSG-6 protein by prokaryotic genetically engineered bacteria and its application in treating inflammatory disease animal models. Background technique [0002] TSG-6 (tumor necrosis factor alpha stimulate gene 6), also known as tumor necrosis factor alpha stimulate gene 6, is a cytokine. Lee et al. discovered the TSG-6 gene for the first time when they screened the cDNA expression library of human diploid FS-4 fibroblasts stimulated by TNF-α (tumor necrosis factoralpha) in the 1990s. The TSG-6 gene exists in most mammalian genomes, and its amino acid sequence has high homology among different species. TSG-6 protein is mainly expressed in chondrocytes, synoviocytes, monocytes, smooth muscle cells, fibroblasts and stem cells with differentiation potential...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/47C12N15/12C12N15/70A61K38/17A61P31/22
CPCA61K38/00A61P31/22C07K14/4718C12N15/70
Inventor王明丽张文昌
OwnerANHUI MEDICAL UNIV