Short-chain dehydrogenase mutant and use thereof
A technology of short-chain dehydrogenases and mutants, applied in applications, oxidoreductases, and the use of vectors to introduce foreign genetic materials, etc., can solve problems such as extreme operating conditions, pollution, and poor selectivity, and achieve the effect of changing selectivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1 Extraction of Bacillus megaterium genomic DNA and cloning of wild-type BmSDR5 gene
[0045] After culturing Bacillus megaterium with LB liquid overnight, centrifuge the fermentation broth in a 1mL centrifuge tube at 3000r / min for 5min, discard the supernatant to collect the cells, and repeat several times to obtain a sufficient amount of cells; b) Lyse the cells with a sufficient amount of DNA Then add 200 μL of phenol: chloroform: isoamyl alcohol, and tightly cover the tube cap to prevent the phenol from leaking out during vortexing; c) vortex at high speed for 3 min; d) centrifuge at 12000 r / min for 5 min, and the supernatant ( About 200 μL) Transfer to a new centrifuge tube; e) After adding 700 μL of pre-cooled absolute ethanol to the supernatant, store it in anhydrous at -20 ° C for 1 hour, centrifuge at 12000 r / min for 15 minutes to precipitate DNA, pour off the ethanol, and use 800 μL of ethanol for precipitation , suspended in ethanol, centrifuged at 12...
Embodiment 2
[0046] Embodiment 2 polymerase chain reaction (PCR)
[0047] Using the extracted Bacillus megaterium genomic DNA as a template for PCR reaction, the reaction system is as follows:
[0048]
[0049] Amplification program: 94°C: 10Min, (94°C: 30s, 45°C: 30s, 72°C: 30s) 35 cycles, 72°C, 10min.
[0050] Primer 1: BmSDR5-BamHI-F: CG GGATCC GATGTTTGAAGAAAAAGTAGGGAT;
[0051] Primer 2: BmSDR5-XhoI-R: CCG CTCGAG CTCAAACCTAAACCCAATCC;
[0052] Restriction endonuclease cut sites are underlined;
[0053] The DNA fragments amplified by PCR were purified using a gel recovery kit. E.coli DH5α containing the pET-22b plasmid was cultured overnight in LB liquid medium at 37°C and 220r / min, and the plasmid was extracted using the reference TIANprep Mini Plasmid Kit. The target fragment and the plasmid pET-22 are limited to double enzyme digestion, and the enzyme digestion system is as follows:
[0054]
Embodiment 3
[0055] Example 3 Preparation and transformation of E.coli DH5α and BL21 competent cells
[0056] a) Take 0.4mL from the seed culture medium and inoculate it into 20mL LB liquid medium and cultivate for 3h; b) 3000r / min, 5min to enrich 2mL of bacteria in 1.5mLEP tube twice, discard the supernatant; c) add 100 Discard the ice-cold TSS solution, resuspend the cells, and ice-bath for 30 minutes; d) Add 20 μL of connection solution (empty plasmid pPICZαA enzyme-digested fragment, target fragment enzyme-digested fragment, and connection solution) and gently swirl to mix well, and ice-bath for 30 minutes; e) Heat shock at 42°C for 60s, ice bath for 2min, and add 600μL LB liquid medium. Cultivate at 37°C and shake at 150r / min for 1h; f) Take 150μL and spread them on ampicillin-resistant LB plates.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


