Unlock instant, AI-driven research and patent intelligence for your innovation.

Polypeptides, recombinant DNA molecules, recombinant vector, exosomes, and applications of polypeptides and exosomes

A technology of DNA molecules and recombinant vectors, which is applied in the direction of recombinant DNA technology, DNA/RNA fragments, and the use of vectors to introduce foreign genetic materials, etc. It can solve the problems of drug toxicity, non-targeting, affecting membrane protein expression and correct folding, etc.

Active Publication Date: 2018-10-09
SUZHOU UNIV
View PDF6 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there are mainly the following problems in the treatment of cardiovascular diseases with drugs: (1) toxicity and non-targeting of drugs; (2) easy to be cleared by the human body, and the half-life of the circulation in the body is very short
In order to ensure the targeting of exosomes, ligand molecules can be expressed on the membrane surface of exosomes, but most of the natural ligands are some macromolecules, which will affect the expression and correct folding of membrane proteins after fusion with membrane proteins. Affects its correct display on the membrane

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polypeptides, recombinant DNA molecules, recombinant vector, exosomes, and applications of polypeptides and exosomes
  • Polypeptides, recombinant DNA molecules, recombinant vector, exosomes, and applications of polypeptides and exosomes
  • Polypeptides, recombinant DNA molecules, recombinant vector, exosomes, and applications of polypeptides and exosomes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1 Phage Screening Cardiomyocyte-specific Targeting Peptides

[0057] ①Screen cardiomyocyte homing peptide: 40 minutes after myocardial infarction in rats, 1×1011 phage clone (Ph.D.-C7C, New England Biolabs) was injected into the left ventricle through the apex, circulated in vivo for 10 minutes, and then injected again PBS was injected into the apex of the heart to elute the unbound phage, the rats were sacrificed, and 40 mg of left ventricular myocardial infarction area and other organs (lung, liver, kidney) tissues were extracted. At the same time, the wild-type M13KE phage library (New England Biolabs) was injected into the heart of another group of myocardial infarction rats. This wild-type phage is a phage without inserted peptides, and its capsid protein does not express peptides. When performing blue-white screening, the wild type has white spots, so it is used as a negative control during screening.

[0058] ② Enrichment of cardiomyocyte homing peptide...

Embodiment 2

[0063] Example 2 Construction of recombinant expression plasmids for exosome membrane proteins and homing peptides

[0064] The DNA sequence corresponding to the artificially synthesized exosome membrane protein (Lamp2b) + the DNA sequence corresponding to the cardiomyocyte homing peptide (CM-peptide, CMP) obtained in Example 1 was inserted into the pRRL-VENUS lentiviral vector to construct Lamp2b -CMP-VENUS recombinant expression vector, the artificially synthesized sequence is as follows (as shown in SEQ ID NO.3):

[0065] GGATCC ATGGTGTGCTTCCGCCTCTTCCCGGTTCCGGGCTCAGGGCTCGTTCTGGTCTGCCTAGTCCTGGGAGCTGTGCGGTCTTATGCATTGGAACTTAATTTGACAGATTCAGAAAATGCCACTTGCCTTTATGCAAAATGGCAGATGAATTTCACAGTACGCTATGAAACTACAAATAAAACTTATAAAACTGTAACCATTTCAGACCATGGCACTGTGACATATAATGGAAGCATTTGTGGGGATGATCAGAATGGTCCCAAAATAGCAGTGCAGTTCGGACCTGGCTTTTCCTGGATTGCGAATTTTACCAAGGCAGCATCTACTTATTCAATTGACAGCGTCTCATTTTCCTACAACACTGGTGATAACACAACATTTCCTGATGCTGAAGATAAAGGAATTCTTACTGTTGATGAACTTTTGGCCATCAGAATTCCATTGAATGACCTTTT...

Embodiment 3

[0066] Example 3 Recombinant plasmid transfection parental cells

[0067] ① Transfect 293T cells by calcium phosphate-DNA co-precipitation method, and package lentiviral plasmid (Lamp2b-CMP-VENUS recombinant expression vector obtained in Example 2). Taking a 10cm petri dish as an example, the amount of plasmid used is as follows:

[0068]

[0069] ②Virus infects target cells

[0070] Since exosomes derived from UMSCs themselves have the effect of repairing myocardial infarction, UMSCs cells are used as parent cells in the present invention to prepare cardiomyocyte-specific exosomes, but the scope of application of the present invention is not limited to UMSCs cells, and is also applicable to in other cells. The UMSCs cells in a good growth state were passaged into a 10cm cell culture dish at a ratio of 1:2, cultured overnight, and the density was about 50% the next day. 2 hours before infection, take the cells out of the incubator, suck off the original medium of the cells...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of biology, and in particular relates to polypeptides, recombinant DNA molecules, a recombinant vector, exosomes, and applications of the polypeptides andthe exosomes. The invention provides a peptide fragment, a screened targeting peptide and an exosome membrane protein lamp2b are constructed to form a recombinant protein by a gene engineering technology, the recombinant protein is expressed on the surfaces of the exosomes, so that myocardial targeting of the exosomes is guaranteed, and a foundation is laid for treatment of myocardial infarction by the exosomes.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to polypeptides, recombinant DNA molecules, recombinant vectors, exosomes and applications thereof. Background technique [0002] Heart failure is the number one killer of human health, and myocardial infarction (myocardial infarction, MI) is the main cause of heart failure. After myocardial infarction, a large number of myocardial cells die, the inflammatory response intensifies, and fibroblasts transform into myofibroblasts, which in turn leads to myocardial fibrosis and eventually heart failure. [0003] At present, there are mainly the following problems in the treatment of cardiovascular diseases with drugs: (1) toxicity and non-targeting of drugs; (2) easy to be eliminated by the human body, and the half-life of the internal circulation is very short. Due to the lack of tissue specificity, in order to achieve an effective concentration at the lesion site, the dosage of the drug i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K7/06C12N15/11C12N15/85C12N5/10C12Q1/02A61K47/42A61P9/10
CPCA61K47/42A61P9/10C07K7/06C12N5/0662C12N15/85C12N2509/00G01N33/5005
Inventor 李杨欣邵联波沈振亚
Owner SUZHOU UNIV