Polypeptides, recombinant DNA molecules, recombinant vector, exosomes, and applications of polypeptides and exosomes
A technology of DNA molecules and recombinant vectors, which is applied in the direction of recombinant DNA technology, DNA/RNA fragments, and the use of vectors to introduce foreign genetic materials, etc. It can solve the problems of drug toxicity, non-targeting, affecting membrane protein expression and correct folding, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Example 1 Phage Screening Cardiomyocyte-specific Targeting Peptides
[0057] ①Screen cardiomyocyte homing peptide: 40 minutes after myocardial infarction in rats, 1×1011 phage clone (Ph.D.-C7C, New England Biolabs) was injected into the left ventricle through the apex, circulated in vivo for 10 minutes, and then injected again PBS was injected into the apex of the heart to elute the unbound phage, the rats were sacrificed, and 40 mg of left ventricular myocardial infarction area and other organs (lung, liver, kidney) tissues were extracted. At the same time, the wild-type M13KE phage library (New England Biolabs) was injected into the heart of another group of myocardial infarction rats. This wild-type phage is a phage without inserted peptides, and its capsid protein does not express peptides. When performing blue-white screening, the wild type has white spots, so it is used as a negative control during screening.
[0058] ② Enrichment of cardiomyocyte homing peptide...
Embodiment 2
[0063] Example 2 Construction of recombinant expression plasmids for exosome membrane proteins and homing peptides
[0064] The DNA sequence corresponding to the artificially synthesized exosome membrane protein (Lamp2b) + the DNA sequence corresponding to the cardiomyocyte homing peptide (CM-peptide, CMP) obtained in Example 1 was inserted into the pRRL-VENUS lentiviral vector to construct Lamp2b -CMP-VENUS recombinant expression vector, the artificially synthesized sequence is as follows (as shown in SEQ ID NO.3):
[0065] GGATCC ATGGTGTGCTTCCGCCTCTTCCCGGTTCCGGGCTCAGGGCTCGTTCTGGTCTGCCTAGTCCTGGGAGCTGTGCGGTCTTATGCATTGGAACTTAATTTGACAGATTCAGAAAATGCCACTTGCCTTTATGCAAAATGGCAGATGAATTTCACAGTACGCTATGAAACTACAAATAAAACTTATAAAACTGTAACCATTTCAGACCATGGCACTGTGACATATAATGGAAGCATTTGTGGGGATGATCAGAATGGTCCCAAAATAGCAGTGCAGTTCGGACCTGGCTTTTCCTGGATTGCGAATTTTACCAAGGCAGCATCTACTTATTCAATTGACAGCGTCTCATTTTCCTACAACACTGGTGATAACACAACATTTCCTGATGCTGAAGATAAAGGAATTCTTACTGTTGATGAACTTTTGGCCATCAGAATTCCATTGAATGACCTTTT...
Embodiment 3
[0066] Example 3 Recombinant plasmid transfection parental cells
[0067] ① Transfect 293T cells by calcium phosphate-DNA co-precipitation method, and package lentiviral plasmid (Lamp2b-CMP-VENUS recombinant expression vector obtained in Example 2). Taking a 10cm petri dish as an example, the amount of plasmid used is as follows:
[0068]
[0069] ②Virus infects target cells
[0070] Since exosomes derived from UMSCs themselves have the effect of repairing myocardial infarction, UMSCs cells are used as parent cells in the present invention to prepare cardiomyocyte-specific exosomes, but the scope of application of the present invention is not limited to UMSCs cells, and is also applicable to in other cells. The UMSCs cells in a good growth state were passaged into a 10cm cell culture dish at a ratio of 1:2, cultured overnight, and the density was about 50% the next day. 2 hours before infection, take the cells out of the incubator, suck off the original medium of the cells...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


