Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Virus-like particle of senecavirus A and preparation method and application thereof

A virus-like, virus technology, applied in positive-sense single-stranded RNA viruses, biochemical equipment and methods, viruses, etc., can solve problems such as non-infectivity, and achieve the effect of improving assembly efficiency

Active Publication Date: 2018-10-12
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Virus-like particle (VLPs) vaccine is a form of vaccine that does not use live virus, but its immunogenicity is almost the same as that of inactivated virus. It is an empty shell structure without viral nucleic acid, and is similar in shape and structure to natural virus particles. Not infectious as it does not contain viral genetic material

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Virus-like particle of senecavirus A and preparation method and application thereof
  • Virus-like particle of senecavirus A and preparation method and application thereof
  • Virus-like particle of senecavirus A and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] The preparation of embodiment 1SVA virus-like particle

[0054] 1. Construction of small ubiquitin-like modified protein fusion expression vectors pSMA, pSMK and pSMC:

[0055] (1) Using Saccharomyces cerevisiae genomic DNA as a template and using smt3F and smt3R as primers to amplify the smt3 gene, the primer sequences are as follows:

[0056] smt3F: 5'GCCATGGGTCATCACCATCATCATCATCACGGGTCGGACTCAGAAGTCAATCAA3'

[0057] smt3R: 5'GGATCCGAGACCTTAAGGTCTCCAACCTCCAATCTGTTCGCGGTG3',

[0058] (2) After double digestion with NcoI and BamHI, insert the smt3 gene into the pET-28a vector treated with the same endonuclease, the resulting vector is pSMK, and replace the kanamycin resistance gene of pSMK with ampicillin resistance Gene or chloramphenicol resistance gene, get vector pSMA and pSMC;

[0059] 2. Construction of SVA structural protein gene recombinant expression vector

[0060] According to the published SVA sequence (GenBank accession number: NC_011349), the codons wer...

Embodiment 2

[0085] The immunogenicity research of embodiment 2SVA virus-like particle

[0086]The antigen for immunization was emulsified with Freund's adjuvant according to the instructions. Fifteen guinea pigs weighing about 300 grams were randomly divided into 3 groups. The first group was immunized with VLPs (prepared in Example 1), the second group was immunized with unassembled proteins, and the third group was injected with PBS as a control. Blood was collected 28 days after immunization to separate serum, and antibody titers and neutralizing antibodies were detected.

[0087] (1) ELISA detection of antibody titer

[0088] A 96-well ELISA plate was coated overnight at 4° C. with 100 μL of SVA hyperimmune serum diluted in 0.05 M sodium carbonate buffer (pH 9.6). Wash with PBST for 3 times, then incubate with SVA virus solution at 37°C for 1 h, wash with PBST for 3 times, and block the well plate with PBST (100 μL) containing 5% skimmed milk powder at 37°C for 1 h. After washing w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a virus-like particle of senecavirus A and a preparation method and application thereof. The virus-like particle of the senecavirus A is assembled by structural protein VP0, structural protein VP1 and structural protein VP3 of the senecavirus A, wherein the gene sequence of the encoding structural protein VP0 is shown in SEQ ID NO.1, the gene sequence of the encoding structural protein VP1 is shown in SEQ ID NO.2, and the gene sequence of the encoding structural protein VP3 is shown in SEQ ID NO.3. The method tries to combine different fusion tags to use so as to improve expression quantity of target proteins and assembling efficiency of the virus-like particle, and the result shows that after the N end of an SUMO VP1 gene combines with GST again, the solubility ofproteins expressed by expression bacterium which is transfected jointly by the combination of the obtained recombinant vector pGST / VP1, pSMK / VP0 and pSMC / VP3 is best, and the assembling efficiency ofVLPS is highest. The method provides technical support for further research and application of virus-like particle vaccines and accelerated transformation of animal vaccines from traditional inactivated vaccines to genetic engineering vaccines.

Description

technical field [0001] The invention relates to a type A Seneca virus virus-like particle, a preparation method and application thereof, and belongs to the technical field of agricultural science, animal husbandry and veterinary medicine. Background technique [0002] Senecavirus A (SVA), also known as Seneca Valley virus (SVV), belongs to the family Picornaviridae Senecavirus. The SVA genome is about 7.2kb long, and it is a single-stranded positive-sense RNA virus without an envelope. The virus particles are typical icosahedral symmetry, and the diameter is about 27nm. In 2002, a company in the United States accidentally discovered SVA in cell cultures. SVA was initially considered to be a contaminant in cell cultures, presumably derived from pig pancreatic enzymes or fetal bovine serum. In 2007, SVA was found to be the causative agent of porcine idiopathic vesicular disease (PIVD) in Canada. In 2014, several severe infection symptoms appeared in Brazil, which caused huge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/04C12N15/70C07K14/085C12Q1/70A61K39/125A61P31/14C12R1/93
CPCA61K39/12A61K2039/5258A61K2039/552A61P31/14C07K14/005C12N7/00C12N15/70C12N2770/32022C12N2770/32023C12N2770/32034C12Q1/70G01N2333/085A61K2039/575C07K16/1009C07K2317/76A61K35/76A61K39/39C12N15/86
Inventor 郭慧琛孙世琪韩世充董虎郭笑然殷宏罗建勋
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com