Application of cotton gene GhDTX27 in plant salt, drought and cold stress tolerance
A technology of cold stress and genetics, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1 Plant Transformation and Overexpression GhDTX27 Arabidopsis Screening
[0025] Through specific primers (F: CGGATCCATGGATGGTGCCCATCGG (SEQ ID No.1); R: GGTCGACTCATTTCGCCCACCTTTTAAC (SEQ ID No.)), the target gene GhDTX27 was cloned, and pWM101-35S: GhDTX27 recombinant vector was constructed to transform Agrobacterium GV3101 competent cells, Wild-type Arabidopsis (Col-0) was infected by flower dipping method. The osmotic medium used for transformation contained MS 4.3 g / L, sucrose 50 g / l (5%), MES 0.5 g / l, Silwet-77 200 μl / l (0.02%), 6-BA 0.01 mg / l, pH 5.7. T0 transgenic lines were positively selected in 1 / 2MS medium containing 50mg / L hygromycin. In order to maximize the germination rate, the seedlings were first vernalized at 4°C for 3 days to break the seed dormancy, and then the seedlings were transferred to the light The incubator is set at 22°C, 16h light / 8h dark. After being cultivated in the selection medium for one week, when the seedlings develop to 3...
Embodiment 2
[0026] Embodiment 2 germination percentage and root elongation measure
[0027]Transgenic lines and wild-type Arabidopsis seeds were tested for tolerance to ABA, salt, drought and cold stress. The T3 generation seeds were sterilized, vernalized at 4°C, and sowed on 1 / 2MS solid medium containing 0, 0.5, 1, and 2 μM ABA, respectively, and 1 / 2MS containing 0, 100, 200, and 300 mM mannitol, respectively. Solid medium and 1 / 2MS solid medium containing 0, 100, 150, and 200 mM NaCl respectively, subjected to ABA, drought, and salt stress treatments, and 1 / 2MS seeded with transgenic homozygous lines and wild-type Arabidopsis The solid medium was placed at 4°C for cold stress treatment, and the germination rates of wild-type and transgenic lines were counted after 10 days.
[0028] Transgenic lines and wild-type Arabidopsis seedlings were tested for tolerance to ABA, salt, drought and cold stress. Seeds of transgenic homozygous lines and wild-type Arabidopsis thaliana were sterilized...
Embodiment 3
[0029] Example 3 Response of Arabidopsis overexpressing GhDTX27 to salt, drought and cold stress tolerance and determination of chlorophyll content, relative water content of leaves, ion conductivity, and dehydration of isolated leaves
[0030] The T3 homozygous transgenic line was sterilized with 10% bleach solution (v / v) for 10 min and washed 3 times with sterile water. The sterilized seeds were then plated on 1 / 2 MS medium, vernalized at 4°C for 3 days, and moved to a 22°C, 16h light / 8h dark photoperiod growth chamber. After 8 days, the seedlings were transplanted into small pots containing nutrient soil, wherein the mixing ratio of vermiculite and humus was 1:1. The seedlings grown for 3 weeks were treated with salt (250mM NaCl) and drought respectively. On the 8th day of treatment, the chlorophyll content, relative water content of leaves, and ion conductance of wild-type and transgenic Arabidopsis in the control group and treatment group were compared. The rate and dehy...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap