Construction and expression method of an engineering strain of Escherichia coli expressing Monascus mn-sod
A technology of Monascus and Escherichia coli, which is applied in the field of bioengineering to achieve the effect of broad application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1, design and screening Monascus ruberum genome Mn-SOD degenerate primers
[0021] (1) Find the Mn-SOD sequence: search the amino acid sequence of the SOD gene from the database NCBI, and select the sequences of the following 6 representative species in the genus Aspergillus: Monascus Aspergillus niger (GeneBank accession number: ABA71743.1 ), Aspergillus fumigatus (GeneBank accession number: EAL90786.1), Aspergillus oryzae (GeneBank accession number: AAU04411.1), Aspergillus laurel (GeneBank accession number: AAU04409.1), Aspergillus niger Aspergillus phoenicis (GeneBank accession number: AAU04413 .1) and Aspergillus flavus (GeneBank accession number: AAU04410.1);
[0022] (2) Block alignment: Log in to Blockmaker, perform Block alignment on the above 6 sequences, and obtain 3 highly conserved contiguous amino acid regions;
[0023] (3) Use primer premier 5.0 for primer analysis: primers cannot contain strong self-complementary sequences; avoid complementarity...
Embodiment 2
[0025] Embodiment 2, degenerate primer PCR amplification obtains the Mn-SOD partial gene of Monascus
[0026] (1) Use the E.Z.N.A.™ Fungal RNA Kit to extract the total RNA of Monascus ruber, and then use ThermoFisher's RevertAid First Strand cDNA Synthesis Kit to amplify its total cDNA;
[0027] (2) Using the total cDNA as a PCR template, use the degenerate primer Forward obtained in Example 1: 5'-GGAATCCATCATGGANNTNCAC-3' (including ECoR I restriction site) and degenerate primer Primer Reverse: 5'-catgccatggacnanccanncccancc-3' (containing NCo I restriction site) to amplify the Mn-SOD gene.
[0028] Reaction system: upHO 133.5µL, 10×buffer 18µL, dNTP (10µmol / L) 3.6µL, upstream primer F 7.2µL, downstream primer R 7.2µL, Taq enzyme 4.5µL, template (63.6ng / µL) 6µL.
[0029] Set the reaction conditions of the PCR instrument: 95°C for 5min, 95°C for 30s, 65°C (62.6°C, 55.9°C, 53.2°C, 51.7°C, 50°C) for 30s, 72°C for 1min, 72°C for 10min, 24°C for 1min; 30 cycles.
[0030] (3) A...
Embodiment 3
[0031] Example 3. Obtaining the full-length gene of Monascus Mn-SOD and constructing pET21a-MnSOD recombinant engineering bacteria
[0032] (1) Use the gel recovery kit to recover the target gene fragment obtained in Example 2, connect it to the pET-39b vector, transform the recombinant vector into Escherichia coli DH5α competent cells, and perform sequence determination on the recombinant strain;
[0033] (2) Design full-length amplification primers according to the nucleotide sequence of the obtained Monascus Mn-SOD gene, and add enzyme cutting sites:
[0034] SODn: ggaattcatggagctgcaccacagcaagc EcoR I restriction site
[0035] SODx: cccaagcttaatagctgccttgagcacc containing Hind III restriction site
[0036] The PCR program is: 94°C for 5min; 95°C for 30s, 55°C for 30s, 72°C for 2min, cycle 30 times, after 10min at 72°C, keep at 5°C for 10min;
[0037] Recover the PCR product, and use the PCR product and plasmid pET21a expression vector separately EcoR I and Hind I...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More